shRNA Stocks (shRNA)

shRNA
View as Grid List

Items 1-12 of 803

Set Descending Direction
Name VDRC Id Library Sub-Category CG Number (r6.01) Genotype Construct Id FlyBase gene number Synonyms 21bp Sequence (antisense) 21bp Sequence (sense) Hairpin Length Insertion Site Vector Sequence RRID Comment Price (net) Add to Cart
330112
330112
shRNA
shRNA Stocks
CG4385
330112
E(Raf)2B
EK2-2
ES2-4
EY2-4
Enhancer of GMR-sina 2-4
S
Star
Star/asteroid
floater
fltr
l(2)05671
l(2)07056
l(2)21Eb
l(2)c00080
l(2)k09538
l(2)rK134
lethal (2) c00080
star
TGAACCACGAGGTCTCCTCGT
ACGAGGAGACCTCGTGGTTCA
attP40
ctagcagtACGAGGAGACCTCGTGGTTCAtagttatattcaagcataTGAACCACGAGGTCTCCTCGTgcg
Sign In to show prices
330113
330113
shRNA
shRNA Stocks
CG4654
330113
49Fk
DDP1
DP
DP transcription factor
DP1
DmDP
Dp
Dp1
TFPD2
dDP
dDP1
dDp
dimerization partner
dp
l(2)49Fk
l(2)vr10
lethal(2)49Fk
vr10
TTTTGATCACAGTTGTTGTCG
CGACAACAACTGTGATCAAAA
attP40
ctagcagtCGACAACAACTGTGATCAAAAtagttatattcaagcataTTTTGATCACAGTTGTTGTCGgcg
Sign In to show prices
330114
330114
shRNA
shRNA Stocks
CG4665
330114
DHPR
Dhpr
Dihydropteridine reductase
TAAAGTGATCGACACAGGCCG
CGGCCTGTGTCGATCACTTTA
attP40
ctagcagtCGGCCTGTGTCGATCACTTTAtagttatattcaagcataTAAAGTGATCGACACAGGCCGgcg
Sign In to show prices
330115
330115
shRNA
shRNA Stocks
CG4672
330115
TMS1
TMS1d
Target of methylation-induced silencing 1
TAATCAGTGACATCAGAGCGA
TCGCTCTGATGTCACTGATTA
attP40
ctagcagtTCGCTCTGATGTCACTGATTAtagttatattcaagcataTAATCAGTGACATCAGAGCGAgcg
Sign In to show prices
330116
330116
shRNA
shRNA Stocks
CG4747
330116
BEST:GH19401
BEST:LD22483
BEST:LD29743
Dm_AI388468
LD29743
TAAATTTCTCCGTCGTATCGC
GCGATACGACGGAGAAATTTA
attP40
ctagcagtGCGATACGACGGAGAAATTTAtagttatattcaagcataTAAATTTCTCCGTCGTATCGCgcg
Sign In to show prices
330117
330117
shRNA
shRNA Stocks
CG4781
330117
4781
CT15357
TTATAACTTCCAACCTCGCCA
TGGCGAGGTTGGAAGTTATAA
attP40
ctagcagtTGGCGAGGTTGGAAGTTATAAtagttatattcaagcataTTATAACTTCCAACCTCGCCAgcg
Sign In to show prices
330118
330118
shRNA
shRNA Stocks
CG4886
330118
CYP33
Cyp33
Dcyp33
cyclophilin-33
cyp33
TAGGCTTGAAACTGTCCTCCT
AGGAGGACAGTTTCAAGCCTA
attP40
ctagcagtAGGAGGACAGTTTCAAGCCTAtagttatattcaagcataTAGGCTTGAAACTGTCCTCCTgcg
Sign In to show prices
330119
330119
shRNA
shRNA Stocks
CG4944
330119
Ciboulot
Ciboulout
EG0007-11
EG:EG0007.11
beta-thymosin
cib
ciboulet
ciboulot
TAGCGTTCTTCAGTTTGTCCT
AGGACAAACTGAAGAACGCTA
attP40
ctagcagtAGGACAAACTGAAGAACGCTAtagttatattcaagcataTAGCGTTCTTCAGTTTGTCCTgcg
Sign In to show prices
330120
330120
shRNA
shRNA Stocks
CG4971
330120
D-Wnt-10
DWnt-10
DWnt10
Dm DWnt10
Wnt oncogene analog 10
Wnt10
wnt10
TTAGAATCTGATTGGTCTCCA
TGGAGACCAATCAGATTCTAA
attP40
ctagcagtTGGAGACCAATCAGATTCTAAtagttatattcaagcataTTAGAATCTGATTGGTCTCCAgcg
Sign In to show prices
330121
330121
shRNA
shRNA Stocks
CG4978
330121
DmMCM7
DmeMCM7
MCM7
McM7
Mcm7
Mcp-PCR1
Minichromosome maintenance 7
Minichromosome maintenance-PCR1
PCR1
anon-EST:Liang-1.66
clone 1.66
dMcm7
mcm7
minichromosome maintenance 7
TGTATCGCCGACAATTGTCGA
TCGACAATTGTCGGCGATACA
attP40
ctagcagtTCGACAATTGTCGGCGATACAtagttatattcaagcataTGTATCGCCGACAATTGTCGAgcg
Sign In to show prices
330122
330122
shRNA
shRNA Stocks
CG5193
330122
TFIIB
TfIIB
Tfiib
TfllB
Transcription factor IIB
dTFIIB
dTfIIB
dmTFIIB
TTATGAGATCCACACTTGTCT
AGACAAGTGTGGATCTCATAA
attP40
ctagcagtAGACAAGTGTGGATCTCATAAtagttatattcaagcataTTATGAGATCCACACTTGTCTgcg
Sign In to show prices
330123
330123
shRNA
shRNA Stocks
CG5373
330123
DmVps34
PI 3-kinase
PI(3)K
PI3-kinase
PI3K
PI3K-59F
PI3K_59F
PI[[3]]K
Phosphotidylinositol 3 kinase 59F
Pi3K59F
Pi3K_59F
VPS34
Vps34
dPI 3-kinase
dPI3K
dVps34
dVps34/PI3K59F
vps34
TAAAAGTCGGACTCAGCAGCT
AGCTGCTGAGTCCGACTTTTA
attP40
ctagcagtAGCTGCTGAGTCCGACTTTTAtagttatattcaagcataTAAAAGTCGGACTCAGCAGCTgcg
Sign In to show prices
Page