shRNA Stocks (shRNA)

shRNA
View as Grid List

Items 37-48 of 803

Set Descending Direction
Name VDRC Id Library Sub-Category CG Number (r6.01) Genotype Construct Id FlyBase gene number Synonyms 21bp Sequence (antisense) 21bp Sequence (sense) Hairpin Length Insertion Site Vector Sequence RRID Comment Price (net) Add to Cart
330148
330148
shRNA
shRNA Stocks
CG7446
330148
CT22917
DmGABA(GRD)
GABA and glycine-like receptor of Drosophila
GABA-and-glycine-receptor-like-subunit-of-Drosophila
GABA/Glycine-gated chloride channel-like
GRD
Glycine receptor
Grd
TAATCGTGTGCAAATAGCTCT
AGAGCTATTTGCACACGATTA
attP40
ctagcagtAGAGCTATTTGCACACGATTAtagttatattcaagcataTAATCGTGTGCAAATAGCTCTgcg
Sign In to show prices
330149
330149
shRNA
shRNA Stocks
CG7496
330149
Dm PGRP-SD
PGRP-SD
Peptidoglycan-recognition protein-SD precursor
pgrp-sd
TTTGCTTGGACATCTGGAAGT
ACTTCCAGATGTCCAAGCAAA
attP40
ctagcagtACTTCCAGATGTCCAAGCAAAtagttatattcaagcataTTTGCTTGGACATCTGGAAGTgcg
Sign In to show prices
330150
330150
shRNA
shRNA Stocks
CG7524
330150
C-src1
D-Src64B
D-src
DSRC64
DSrc
DSrc64
DSrc64B
Dm SRC1
DmHD-358
Dsrc
Dsrc64
Dsrc64B
HD-358
MRE5
SRC 64B
SRC64B
Src
Src oncogene at 64B
Src proto oncogene sequence
Src1
Src64
Src64B
Src64b
TAGTGCTTCACATGGTATCCA
TGGATACCATGTGAAGCACTA
attP40
ctagcagtTGGATACCATGTGAAGCACTAtagttatattcaagcataTAGTGCTTCACATGGTATCCAgcg
Sign In to show prices
330151
330151
shRNA
shRNA Stocks
CG7576
330151
AAF58762
DRAB3
DRab3
DmRab3
Drab3
P25228
Rab-protein 3
Rab3
Rab3A
dm-Rab3
drab3
rab3
TAAAACTGTCCTCATTAGTGA
TCACTAATGAGGACAGTTTTA
attP40
ctagcagtTCACTAATGAGGACAGTTTTAtagttatattcaagcataTAAAACTGTCCTCATTAGTGAgcg
Sign In to show prices
330152
330152
shRNA
shRNA Stocks
CG7581
330152
BUB3
Bub3
Dmbub3
bub3
dBUB3
TTAAGCTTGAACTCTGGGGGA
TCCCCCAGAGTTCAAGCTTAA
attP40
ctagcagtTCCCCCAGAGTTCAAGCTTAAtagttatattcaagcataTTAAGCTTGAACTCTGGGGGAgcg
Sign In to show prices
330153
330153
shRNA
shRNA Stocks
CG7644
330153
BG:DS00365.4
BcDNA:RE51929
Beat-Ib
CT23325
beat Ib
beat-B
beat-Ib
beaten path Ib
TAAATTTCGTGTATCCTTGCC
GGCAAGGATACACGAAATTTA
attP40
ctagcagtGGCAAGGATACACGAAATTTAtagttatattcaagcataTAAATTTCGTGTATCCTTGCCgcg
Sign In to show prices
330154
330154
shRNA
shRNA Stocks
CG7753
330154
CG30132
Mei-W68
MeiW68
W68
l(2)k05603
mei W-68
mei-W68
meiW68
meiotic W68
spo11
TTATTATAGCTGACTCGTCGA
TCGACGAGTCAGCTATAATAA
attP40
ctagcagtTCGACGAGTCAGCTATAATAAtagttatattcaagcataTTATTATAGCTGACTCGTCGAgcg
Sign In to show prices
330155
330155
shRNA
shRNA Stocks
CG8107
330155
CALPB
CalpB
Calpain B
Calpain-B
calpB
calpain B
calpainB
TAAAATGTGGTGAACGCGCCA
TGGCGCGTTCACCACATTTTA
attP40
ctagcagtTGGCGCGTTCACCACATTTTAtagttatattcaagcataTAAAATGTGGTGAACGCGCCAgcg
Sign In to show prices
330156
330156
shRNA
shRNA Stocks
CG8184
330156
URE-B1/CG8184
TATCGATGCAGTCACGAACCA
TGGTTCGTGACTGCATCGATA
attP40
ctagcagtTGGTTCGTGACTGCATCGATAtagttatattcaagcataTATCGATGCAGTCACGAACCAgcg
Sign In to show prices
330157
330157
shRNA
shRNA Stocks
CG8279
330157
DmPDE5/6
DmPDE6
PDE6
Pde6
Phosphodiesterase 6
TTGATAGCTTCGATCGAACTG
CAGTTCGATCGAAGCTATCAA
attP40
ctagcagtCAGTTCGATCGAAGCTATCAAtagttatattcaagcataTTGATAGCTTCGATCGAACTGgcg
Sign In to show prices
330158
330158
shRNA
shRNA Stocks
CG8454
330158
DmVps16
V16
Vacuolar protein sorting 16A
Vps16
Vps16A
dVps16A
vps16A
TGTAGTAGTCCGGTCGCACCT
AGGTGCGACCGGACTACTACA
attP40
ctagcagtAGGTGCGACCGGACTACTACAtagttatattcaagcataTGTAGTAGTCCGGTCGCACCTgcg
Sign In to show prices
330159
330159
shRNA
shRNA Stocks
CG8602
330159
anon-WO0118547.349
anon-WO0118547.382
TTACGCTGCAAAATCCGCTCG
CGAGCGGATTTTGCAGCGTAA
attP40
ctagcagtCGAGCGGATTTTGCAGCGTAAtagttatattcaagcataTTACGCTGCAAAATCCGCTCGgcg
Sign In to show prices