shRNA Stocks (shRNA)

shRNA
View as Grid List

Items 25-36 of 803

Set Descending Direction
Name VDRC Id Library Sub-Category CG Number (r6.01) Genotype Construct Id FlyBase gene number Synonyms 21bp Sequence (antisense) 21bp Sequence (sense) Hairpin Length Insertion Site Vector Sequence RRID Comment Price (net) Add to Cart
330136
330136
shRNA
shRNA Stocks
CG6416
330136
Z band alternatively spliced PDZ-motif protein 66
ZASP66
Zaps66
Zasp66
anon-WO0153538.30
TAGTGCCTCAAGTAGGACTCT
AGAGTCCTACTTGAGGCACTA
attP40
ctagcagtAGAGTCCTACTTGAGGCACTAtagttatattcaagcataTAGTGCCTCAAGTAGGACTCTgcg
Sign In to show prices
330137
330137
shRNA
shRNA Stocks
CG6603
330137
0041/12
0318/20
1342/17
1348/02
1485/13
BEST:LD32772
HSC-70
HSC70
HSC70cb
HSP110
HSP110-1
Hsc70
Hsc70Cb
LD32772
anon-WO0118547.302
dHsp110
hsc70Cb
hsc70cb
l(3)00082
l(3)07621
l(3)134217
l(3)14
TTCCGTTAGATGATCGTACTT
AAGTACGATCATCTAACGGAA
attP40
ctagcagtAAGTACGATCATCTAACGGAAtagttatattcaagcataTTCCGTTAGATGATCGTACTTgcg
Sign In to show prices
330138
330138
shRNA
shRNA Stocks
CG6647
330138
DVDAC
DmPorin1
DmVDAC
POR-1
PORIN
Porin
Porin 1
VDAC
Vdac
Voltage-dependent anion-selective channel
anon-WO02059370.56
cg6647
l(2)k05123
mitochondrial porin
porin
porin 1
TAGGCAACCTTGAACTTGCCG
CGGCAAGTTCAAGGTTGCCTA
attP40
ctagcagtCGGCAAGTTCAAGGTTGCCTAtagttatattcaagcataTAGGCAACCTTGAACTTGCCGgcg
Sign In to show prices
330139
330139
shRNA
shRNA Stocks
CG6936
330139
MTH
Methuselah
Mth
methusalah
methuselah
mth
TCTAGGTAGAACATTCCGTCA
TGACGGAATGTTCTACCTAGA
attP40
ctagcagtTGACGGAATGTTCTACCTAGAtagttatattcaagcataTCTAGGTAGAACATTCCGTCAgcg
Sign In to show prices
330140
330140
shRNA
shRNA Stocks
CG6986
330140
Proc R
Proc-R
ProcR
Proctolin receptor
anon-WO0170980.73
anon-WO0170980.74
proctolin receptor
TATATGTTCGTCGTGCATCTC
GAGATGCACGACGAACATATA
attP40
ctagcagtGAGATGCACGACGAACATATAtagttatattcaagcataTATATGTTCGTCGTGCATCTCgcg
Sign In to show prices
330141
330141
shRNA
shRNA Stocks
CG6992
330141
D-GluRIIA
DGluR-II
DGluR-IIA
DGluR2a
DGluRIIA
DGluRIIa
DgluRII
DmelGluRIIA
Glu-RII
Glu-RIIA
GluR
GluR-IIA
GluR2
GluR2a
GluRII
GluRII-A
GluRIIA
GluRIIa
GluR[[IIa]]
GlurIIA
Glutamate receptor IIA
TTTCGCAGCTTGACATAGTCA
TGACTATGTCAAGCTGCGAAA
attP40
ctagcagtTGACTATGTCAAGCTGCGAAAtagttatattcaagcataTTTCGCAGCTTGACATAGTCAgcg
Sign In to show prices
330142
330142
shRNA
shRNA Stocks
CG7037
330142
CBL
CG7043
Cbl
D-Cbl
D-Cbl L
D-cbl
D-cblL
D-cblLONG
D-cblS
D-cblSHORT
DCbl
Dcbl
Dv-Cbl
Dv-cbl
F165
anon-WO0118547.68
cable
cbl
d-cbl
dCbl
v-Cbl
TTGTCTGCAGAATCTCTCCCT
AGGGAGAGATTCTGCAGACAA
attP40
ctagcagtAGGGAGAGATTCTGCAGACAAtagttatattcaagcataTTGTCTGCAGAATCTCTCCCTgcg
Sign In to show prices
330143
330143
shRNA
shRNA Stocks
CG7098
330143
ADA3
Ada3
DADA3
HL-XIV
dADA3
dAda3
dik
diskette
TTCGCTTGTAGCACTCGAGTA
TACTCGAGTGCTACAAGCGAA
attP40
ctagcagtTACTCGAGTGCTACAAGCGAAtagttatattcaagcataTTCGCTTGTAGCACTCGAGTAgcg
Sign In to show prices
330144
330144
shRNA
shRNA Stocks
CG7105
330144
PROC
PROCT
Prct
Proc
Proct
Proctolin
proct
proctolin
AACTTGTCCAAATCGTCGCCA
TGGCGACGATTTGGACAAGTT
attP40
ctagcagtTGGCGACGATTTGGACAAGTTtagttatattcaagcataAACTTGTCCAAATCGTCGCCAgcg
Sign In to show prices
330145
330145
shRNA
shRNA Stocks
CG7210
330145
Dm.Ring_canal/KELC_DROME
Kel
Kelch
kel
kelch
TTCGTTTCACAATCGTAGGCT
AGCCTACGATTGTGAAACGAA
attP40
ctagcagtAGCCTACGATTGTGAAACGAAtagttatattcaagcataTTCGTTTCACAATCGTAGGCTgcg
Sign In to show prices
330146
330146
shRNA
shRNA Stocks
CG7393
330146
186F5S
BG:DS00797.3
D-p38
D-p38 MAPK
D-p38b
Dm p38b
Dmp38b
Dp38
Dp38b
ESTS:186F5S
MAPK
Mpk34C
anon-sts23
dp38b
p38
p38 MAPK
p38 beta
p38 mitogen-activated protein kinase
p38B
p38Kb
p38b
p38b M
TATCCGGTCATCTCGCTTTCT
AGAAAGCGAGATGACCGGATA
attP40
ctagcagtAGAAAGCGAGATGACCGGATAtagttatattcaagcataTATCCGGTCATCTCGCTTTCTgcg
Sign In to show prices
330147
330147
shRNA
shRNA Stocks
CG7404
330147
ERR
NR3B4
dERR
estrogen related receptor
estrogen-related receptor
TAGTAGAACTCCGTGTAACCG
CGGTTACACGGAGTTCTACTA
attP40
ctagcagtCGGTTACACGGAGTTCTACTAtagttatattcaagcataTAGTAGAACTCCGTGTAACCGgcg
Sign In to show prices