RNAi Libraries

For more information about our RNAi Libraries, please check out our information page.

For explanations of fields, please checkout out our field definitions.

Shop By
Shopping Options
OFF Targets
  1. 0 23479item
  2. 1 7538item
  3. 2 2155item
  4. 3 789item
  5. 4 401item
  6. 5 265item
  7. 6 183item
  8. 7 147item
  9. 8 106item
  10. 9 93item
  11. 10 88item
  12. 11 29item
  13. 12 43item
  14. 13 60item
  15. 14 44item
  16. 15 43item
  17. 16 33item
  18. 17 36item
  19. 18 15item
  20. 19 17item
  21. 20 20item
  22. 21 19item
  23. 22 10item
  24. 23 20item
  25. 24 21item
  26. 25 12item
  27. 26 19item
  28. 27 10item
  29. 28 5item
  30. 29 11item
  31. 30 7item
  32. 31 5item
  33. 32 8item
  34. 33 6item
  35. 34 6item
  36. 35 5item
  37. 36 7item
  38. 37 9item
  39. 38 3item
  40. 39 3item
  41. 40 4item
  42. 41 4item
  43. 42 2item
  44. 43 5item
  45. 44 5item
  46. 45 3item
  47. 46 3item
  48. 47 8item
  49. 48 8item
  50. 49 2item
  51. 51 5item
  52. 52 7item
  53. 53 1 item
  54. 54 1 item
  55. 55 3item
  56. 56 7item
  57. 57 4item
  58. 58 8item
  59. 60 2item
  60. 61 2item
  61. 62 3item
  62. 63 3item
  63. 64 4item
  64. 65 2item
  65. 66 1 item
  66. 67 1 item
  67. 68 1 item
  68. 69 5item
  69. 70 7item
  70. 71 11item
  71. 72 2item
  72. 73 5item
  73. 75 2item
  74. 76 2item
  75. 77 1 item
  76. 78 4item
  77. 79 4item
  78. 80 2item
  79. 81 2item
  80. 84 3item
  81. 85 4item
  82. 86 3item
  83. 87 2item
  84. 88 2item
  85. 89 3item
  86. 90 3item
  87. 91 1 item
  88. 92 1 item
  89. 93 2item
  90. 94 4item
  91. 95 8item
  92. 96 3item
  93. 99 2item
  94. 102 10item
  95. 103 1 item
  96. 104 1 item
  97. 105 4item
  98. 106 4item
  99. 109 2item
  100. 112 2item
  101. 113 2item
  102. 114 2item
  103. 115 1 item
  104. 118 2item
  105. 119 3item
  106. 120 1 item
  107. 121 3item
  108. 122 4item
  109. 126 2item
  110. 127 4item
  111. 136 2item
  112. 137 5item
  113. 138 2item
  114. 139 1 item
  115. 142 1 item
  116. 143 3item
  117. 144 2item
  118. 145 2item
  119. 146 4item
  120. 150 2item
  121. 154 2item
  122. 158 5item
  123. 159 4item
  124. 160 6item
  125. 161 3item
  126. 162 3item
  127. 163 2item
  128. 167 3item
  129. 171 2item
  130. 173 6item
  131. 176 1 item
  132. 177 1 item
  133. 179 3item
  134. 180 6item
  135. 181 2item
  136. 182 2item
  137. 190 1 item
  138. 191 1 item
  139. 195 1 item
  140. 196 1 item
  141. 200 1 item
  142. 201 2item
  143. 203 4item
  144. 208 1 item
  145. 209 3item
  146. 210 1 item
  147. 219 2item
  148. 220 3item
  149. 223 2item
  150. 224 2item
  151. 225 3item
  152. 226 6item
  153. 229 2item
  154. 230 2item
  155. 231 1 item
  156. 234 1 item
  157. 235 2item
  158. 240 2item
  159. 242 4item
  160. 245 3item
  161. 249 2item
  162. 250 2item
  163. 253 1 item
  164. 259 4item
  165. 260 1 item
  166. 261 3item
  167. 264 2item
  168. 267 4item
  169. 269 2item
  170. 271 3item
  171. 274 2item
  172. 275 1 item
  173. 282 3item
  174. 287 2item
  175. 288 2item
  176. 289 4item
  177. 291 4item
  178. 292 2item
  179. 296 2item
  180. 299 1 item
  181. 302 2item
  182. 306 2item
  183. 310 4item
  184. 316 2item
  185. 317 1 item
  186. 318 1 item
  187. 321 1 item
  188. 323 2item
  189. 325 4item
  190. 327 2item
  191. 328 1 item
  192. 333 3item
  193. 334 1 item
  194. 343 2item
  195. 348 1 item
  196. 351 1 item
  197. 353 2item
  198. 354 2item
  199. 358 2item
  200. 363 2item
  201. 372 2item
  202. 375 1 item
  203. 376 2item
  204. 384 1 item
  205. 385 4item
  206. 391 2item
  207. 395 1 item
  208. 399 1 item
  209. 400 3item
  210. 403 2item
  211. 409 2item
  212. 410 2item
  213. 413 2item
  214. 414 1 item
  215. 419 5item
  216. 421 1 item
  217. 429 1 item
  218. 430 1 item
  219. 432 1 item
  220. 433 1 item
  221. 437 1 item
  222. 438 2item
  223. 441 1 item
  224. 445 1 item
  225. 448 2item
  226. 449 1 item
  227. 450 2item
  228. 453 1 item
  229. 454 3item
  230. 458 1 item
  231. 460 2item
  232. 461 2item
  233. 463 3item
  234. 464 4item
  235. 465 1 item
  236. 466 3item
  237. 467 1 item
  238. 470 2item
  239. 471 6item
  240. 473 1 item
  241. 474 2item
  242. 475 3item
  243. 476 2item
  244. 479 1 item
  245. 480 2item
  246. 481 1 item
  247. 484 3item
  248. 485 1 item
  249. 489 2item
  250. 491 1 item
  251. 492 2item
  252. 494 4item
  253. 498 2item
  254. 505 2item
  255. 506 2item
  256. 508 2item
  257. 510 1 item
  258. 512 1 item
  259. 519 1 item
  260. 520 2item
  261. 521 1 item
  262. 525 2item
  263. 530 2item
  264. 536 1 item
  265. 538 2item
  266. 539 1 item
  267. 540 2item
  268. 545 2item
  269. 547 1 item
  270. 548 2item
  271. 551 2item
  272. 553 1 item
  273. 564 2item
  274. 565 2item
  275. 569 1 item
  276. 579 2item
  277. 582 2item
  278. 584 2item
  279. 587 2item
  280. 591 2item
  281. 593 2item
  282. 601 1 item
  283. 602 2item
  284. 603 1 item
  285. 604 1 item
  286. 610 2item
  287. 611 2item
  288. 622 1 item
  289. 623 2item
  290. 626 2item
  291. 627 1 item
  292. 631 1 item
  293. 633 4item
  294. 638 2item
  295. 639 1 item
  296. 641 2item
  297. 656 3item
  298. 659 2item
  299. 663 1 item
  300. 669 2item
  301. 673 2item
  302. 677 2item
  303. 680 2item
  304. 682 2item
  305. 683 3item
  306. 686 2item
  307. 690 1 item
  308. 691 1 item
  309. 705 2item
  310. 713 2item
  311. 716 3item
  312. 721 1 item
  313. 722 1 item
  314. 725 3item
  315. 728 1 item
  316. 730 1 item
  317. 732 1 item
  318. 737 1 item
  319. 742 1 item
  320. 747 3item
  321. 754 2item
  322. 764 2item
  323. 773 2item
  324. 776 1 item
  325. 780 1 item
  326. 783 3item
  327. 800 2item
  328. 805 2item
  329. 850 1 item
  330. 855 1 item
  331. 878 1 item
View as Grid List

Items 1-12 of 37254

Set Descending Direction
Name VDRC Id Library Sub-Category CG Number (r6.01) Genotype Construct Id FlyBase gene number Synonyms Left Primer Right Primer Hairpin Length Insertion Site Vector Template Sequence FlyBase Reference Reports RRID Comment Price (net) Add to Cart
7042
7042
GD
CG42594
3229
CG15470
CG32770
CG32771
CG6952
CGCGAATTCGCCCATCCTGCTCTGCTTCTCC
CGCTCTAGACACCTGCACCACCCGACACA
353
genomic
GCCCATCCTGCTCTGCTTCTCCATGATGATCATCTACATCGTTTTCGGTGCTGCCGTCTTATATCGCCTGGAAAAATGGCCCATTCTGGATGGCATATACTTTTGCTTTATGAGCCTGTCCACCATTGGTTTTGGCGATATGCTGCCGGGACTGCGACGGGAATCGAATGCCACCACCTGGTTTTGTTCGGTTTACATAATGTCGGGCATGACGCTAACGGCCATGTGTTTCAATGTCATACACGAGGAGATTGTCCATCGCATTCGCATTGTGGTGGAGTTTAAGAAGACGAGTGCCGCTAACTCGGGCGGCGGTTTGATCGGCGGCGGCAGTGTGTCGGGTGGTGCAGGTG
Sign In to show prices
7061
7061
GD
CG16752
3236
CG12731
SPR
Sex peptide receptor
sex peptide receptor
CGCGAATTCCAGCCCGGAAATGGAAATGGA
CGCTCTAGACTTCTTGCTCAAAACGAGCACAATCAG
301
genomic
CAGCCCGGAAATGGAAATGGAACTGGCCGATCCGCGTCAGATGGTCCGCGGATTTCATCTGCCAACCAACGAGTCGCAGTTGGAGATTCCCGACTATGGCAACGAGAGCCTGGACTATCCCAACTACCAGCAGATGGTCGGCGGACCGTGTCGCATGGAGGACAACAATATCAGCTATTGGAATCTCACCTGCGATTCGCCACTGGAGTACGCTATGCCGCTCTATGGCTACTGTATGCCCTTCCTGCTGATCATCACCATTATCTCGAACTCCCTGATTGTGCTCGTTTTGAGCAAGAAG
Sign In to show prices
7070
7070
GD
CG3160
3240
CGCGAATTCTCATCAGCAGCCGTGTGTTTCC
CGCTCTAGAGAGGGCTTTCCACGCACCAA
391
genomic
TCATCAGCAGCCGTGTGTTTCCGGAGCCAGAGCCATTGGACTACAGCATCAATGTGTCCATTGTTATCCACTGTGCGGCCATTGCCTTGTCCCTGCTGGCCACGCTGGGCACTTGGTTGGCCCTGACGCTCTATGGCAACGCCTTCTACCGCCTAGCCCTGCGTATAACGCGCCTTTCCCAGGCAACCTCCAATGTGATGATCTCGATCATGACCCACTTGCCCATTACGTACGGTATACTAACTATTGCCACGGCCATGGGCACTTGCAGCGGAGTGGGTCTTCTCCTGGCCTTTGTCTTCTACTTTCTGATGCTCTCGAATGCTTACAAGGATTATCTGGAGGATTTCCTATGGCAGAAGGCGGCTAATTTGGTGCGTGGAAAGCCCTC
Sign In to show prices
7073
7073
GD
CG3149
3241
BcDNA:GH08388
CGCGAATTCTTGTCGCCCAGGTCTTTTGCTTT
CGCTCTAGAGCGTTTGCAGTTCCCGGTTG
372
genomic
TTGTCGCCCAGGTCTTTTGCTTTGTCAAGCTTAAGATCCTGCTGAATACGCTGCACATCCTGGTGCGCTCGGCCATCTTCCTGTGGATTGTCACCGGTGATCGCAGTGCGGCAATCAATGCATTTGCGATTGCCCAACTATCCAGCGCAGTGACCATTGTCCTGGGCCAATATGGCTTCTTTTACTTCTATCTGAAGGGCTTCAAGGATTTCGTGACCCAGCAGGCGAAAAAGAAACCAGTGGCTCCAAAAGCCTGGCAGGTCTCACTGTACGAGCACATGGATGACTTCCCCTTCAAGCAGCTGAGCGACTTCCTGCCCGGCGTGATGTTCAATCCAAATGGAAAGCATTTCAACCGGGAACTGCAAACGC
Sign In to show prices
7078
7078
GD
CG4052
3243
Cpr5C
Cuticular protein 5C
CGCGAATTCGGCCAGTTGTACCATGCTGCTC
CGCTCTAGACACGGTCTTCACCAGCGGTTC
321
genomic
GGCCAGTTGTACCATGCTGCTCCGGTTGCCACCTATGCGGCACCAGCTCCCGCTGCCGTCCTGAAGACCGTCGCCCAACCGGTGCTGGCCAAGGCCGATGAGGAGTACGATCCCCATCCGCAGTACAAGTACGCCTACGATGTGCAGGACGCCATCTCGGGCGACTCCAAGAGCCAGGTGGAGGAGCGCGACGGGGACGTGGTACGCGGAGAGTACTCCCTGGTCGATTCCGATGGCTTCAAGCGCACGGTGCAGTACACTGCCGATCCAATCAATGGATTCAATGCCGTGGTCAATCGCGAACCGCTGGTGAAGACCGTG
Sign In to show prices
7086
7086
GD
CG3033
3245
GAA1
Glycosylphosphatidylinositol anchor attachment 1 ortholog (H. sapiens)
CGCGAATTCCTGGCAATCATGGGCTGTTCC
CGCTCTAGATTCCGCCTCCTGTTCGTGCT
365
genomic
CTGGCAATCATGGGCTGTTCCACCGTTATCGGATCGATGCTTTGACCATAGCTGCCAATCGAAGGGCCACCCATGCCACACTGAAGGGCAGCCCAGGATCGGCAGCGGTGCCTTTGCTGAAGGCCATCGAGGGAATAGCCAGGAGTCTGAACAACCTTCTGGAGCGCTTCCATCAAAGCTTTTTCTTCTATGTGATCGTAAGCAACGATCGCTACATCTCCATTGGGGATTATATGCCCGCTTTGGTGGCTCTGGTAGCTTGTGCCTTCCTTAAGGCCTATCTAACGTGGTCCACGCTCCCGGCGACCAACGCTGAGCTGGAAAAGGCCGCTGGCTGGCTTAGGGAGCACGAACAGGAGGCGGAA
Sign In to show prices
7094
7094
GD
CG6048
3247
SP108
CGCGAATTCCGCACCAACACGCTAACATTCAC
CGCTCTAGAGCATCCTTTTCTCCCACCTCCA
350
genomic
CGCACCAACACGCTAACATTCACGATCGAAGAGCGCATAATGCAGCTGGATAAGTTCGACCTTTCCACCTACGACAAGGACATCGCCCTGCTGATGCTGAATGGTACTGTACCCACTGGACATCCGACCATTCGTCCAATTGCCCTCAATCGGTTTGCCATACCGGAGGGCGTCGTCTGCCAGGTGACGGGCTGGGGCAATACGGAGGATGGCTATGTCTCCGACATCCTGATGACCGTCGATGTGCCGATGATCAGCGAGGAGCATTGCATCAATGACAGCGACCTGGGCCACCTGATTCAGCCGGGAATGATATGTGCCGGTTATTTGGAGGTGGGAGAAAAGGATGC
Sign In to show prices
7098
7098
GD
CG6067
3248
CGCGAATTCCCACATCCACCAGCCTCCAAA
CGCTCTAGACCCAACAAACGATCCCGTTCC
348
genomic
CCACATCCACCAGCCTCCAAAGGACCTGGCTCTTGCCATTCTTATGCTGGACAAGGATGTGCCTGAGAATCTTCCATATATTCAAGCAATTGGTCTACCTACTCCTGGAGCCACTTCCATCCTGGACTCGGATCATCATAATCTTCTACAGATTAACACCTGGGGCTATGATGGCGATATTCGCGAGCTGCACGATCTGGTCACATTGAATGCCACTCACACATCCTGCCATCAGCATCAGAGTAAATCGCCAAGGATTTGTGTCCAGCCGAAAACCAGCAACTACATTCGTGGCCGGCTTTACATGGATGCCGGTGCCACGCTGACGGAACGGGATCGTTTGTTGGG
Sign In to show prices
7113
7113
GD
CG3781
3255
Q9W422
CGCGAATTCCGGGAATGAAAACGGGAATGG
CGCTCTAGATGTGGAAGGGCAGTGGGATGTAG
392
genomic
CGGGAATGAAAACGGGAATGGAAGTGGAAACGGAAACACCACAATGATGCCGCATGGAATCTACCATGAGCGGCAGACACGTCACCTGTGCGGCCTCCACGCACTGAACAATCTGTTCCAGGGGCCCGACATGTTCTCCAAATCGGAACTGGACGACTACTGCACCACATTGACCCCGCGCAACTGGCTGAATCCGCATCGATCGTGGATCGGTTGGGGCAACTACGACGTCAATGTGATCATGTACGCCCTGCAGCAGCGGAATTGCGAGGCGGTGTGGTTTGATCGACGGCGGGATCCACACTGTCTCAATCTGAGCGTCATTTTCGGCTTCATTCTCAATGTACCGGCTCAGATGAGCCTGGGCTACTACATCCCACTGCCCTTCCACA
Sign In to show prices
7117
7117
GD
CG3842
3256
lincRNA.959
CGCGAATTCCAGTCGCATTGTGGTGGTCAGTTC
CGCTCTAGAGCGCCAGCCTTGGGTGTCTT
300
genomic
CAGTCGCATTGTGGTGGTCAGTTCGGCGGCACATCTCTTTGGGCGAATCAACCGCGAGGATCTGATGAGCGAGAAGAACTACAGCAAGTTCTTTGGGGCGTACAGTCAGTCCAAGCTGGCCAACATCCTGTTTACCCTCAAGCTGAGCACCATCCTTAAGGACACCGGCGTAACGGTGAACTGTTGTCATCCGGGTGTGGTCCGCACCGAGATCAACCGCCACTTTTCCGGTCCCGGCTGGATGAAGACCGCCCTGCAGAAGGGCTCGCTGTACTTCTTTAAGACACCCAAGGCTGGCGC
Sign In to show prices
7128
7128
GD
CG4536
3260
CT14708
DmIav
IAV
INACTIVE
Iav
Inactive
TRPV
hypoB
iav
inactive
osm-9
CGCGAATTCCGGGAGCAGTTTGGCGTCTT
CGCTCTAGACCTCGCCCTCCATCACATCC
310
genomic
CGGGAGCAGTTTGGCGTCTTCATGTACAACGATGGCAAGGGCCAGGTGATAAACCGTGCTGAGTTTCTGCGCTGGAAGTACCGCGACCACACCGAGGTGACCATACCCATTGAGGCATCCCTGTCCATCCACGATCCGCTGGGCAAATGGGAGGACCACAAGGCCTGCTGGCAGATGCAGTACCGCGGCGCCCTGGGCGAGAGTCTGCTCCATGTGCTCATCATCTGCGATTCCAAGGTGCACACCAAGTTGGCGCGCGTGCTGCTCCGCGTGTTCCCCAATCTGGCGCTGGATGTGATGGAGGGCGAGG
Sign In to show prices
7132
7132
GD
CG4542
3261
Dalg8
xiantuan
xit
CGCGAATTCCGCTGGTAAACCGGGAGGATG
CGCTCTAGACGGATGTGGACGATGCGATG
399
genomic
CGCTGGTAAACCGGGAGGATGCCAGATACGCCTATGTCCTTGGCATTGCCGGCTATTTCTCTCTCTTTCCGCTGCTCTTCGATGCGGATCTGTACATTCCCCGGTATTCCCTGTACATGTCGTACGTGGCCATGATGTACGGCCAGCTGTATCGCATCTTCCCCGGCTTCCGAGGCTTCCACACGCTGGAGTGGCTATACATGCTGGGCTTCATGGCTATTCCGCTGTACGAGCATCTGCTCTCTTTCCTGCTGCACCTGGACCAGCGCCTGCCCTTCTTGCCCCTACTGCTGACCTCCGTGTACTCGGCGTTGGGAGTGCTCTACTTCTTTGGGGCCTACTATCTGTACGCTCTGGGCATTAGCTGGGGCAAGGTGCCCATCGCATCGTCCACATCCG
Sign In to show prices
Page