J. Brennecke Stocks (JB-STOCK)

JB-STOCK
View as Grid List

Items 73-84 of 261

Set Descending Direction
Name VDRC Id Library Sub-Category Genotype Description Construct Id Chromosome(s) Publication Provider Scientist Provider Organization FlyBase gene number Synonyms Sequence Keywords RRID Comment Name Price (net) Add to Cart
313340
313340
JB-STOCK
Tagged construct
; ; EGFP_Rhi [attP2];
BAC-construct containing the rhino locus with N-terminal EGFP tag; plasmid JB96, Glycerol #214
313340
-1
rhi
empty
BAC-construct containing the rhino locus with N-terminal EGFP tag; plasmid JB96, Glycerol #214
; ; EGFP_Rhi [attP2];
Sign In to show prices
313345
313345
JB-STOCK
Tagged construct
; If/ CyO; GFP_Shu; ;
BAC-construct containing the shutdown locus with N-terminal GFP-tag
313345
-1
shu
empty
BAC-construct containing the shutdown locus with N-terminal GFP-tag
; If/ CyO; GFP_Shu; ;
Sign In to show prices
313350
313350
JB-STOCK
Tagged construct
w; GFP_CG31755 [attP40]/CyO; ;
BAC construct containg the CG31755 locus with N-terminal GFP-tag; tag inserted at an ATG that was the predicted start codon in a previous FlyBase version (TCAACTGAGGCGATGTACAACGGCG)
313350
-1
SoYb
empty
BAC construct containg the CG31755 locus with N-terminal GFP-tag; tag inserted at an ATG that was the predicted start codon in a previous FlyBase version (TCAACTGAGGCGATGTACAACGGCG)
w; GFP_CG31755 [attP40]/CyO; ;
Sign In to show prices
313351
313351
JB-STOCK
Tagged construct
w; ; 3xFLAG/V5/Precission/GFP_sbr [attP2]/TM3,Sb;
Pacman CH322-120I06 containing the sbr locus with N-terminal 3xFLAG_V5_Precission_GFP; plasmid JB457; Glycerol #690
313351
-1
sbr
empty
Pacman CH322-120I06 containing the sbr locus with N-terminal 3xFLAG_V5_Precission_GFP; plasmid JB457; Glycerol #690
w; ; 3xFLAG/V5/Precission/GFP_sbr [attP2]/TM3,Sb;
Sign In to show prices
313368
313368
JB-STOCK
Tagged construct
w; EGFP_vas [attP40]; ;
BAC-construct containing the vasa locus withN-terminal EGFP tag; plasmid JB94, Glycerol #212
313368
-1
vas
empty
BAC-construct containing the vasa locus withN-terminal EGFP tag; plasmid JB94, Glycerol #212
w; EGFP_vas [attP40]; ;
Sign In to show prices
313386
313386
JB-STOCK
tethering lines
; pUASp>lambdaN-HA-Mael [attP40]/CyO; tub>EGFP_5xBoxB_SV40 [attP2]/TM3, Ser;
cross to germline specific Gal4 for tethering Mael to 3'UTR of GFP-reporter (based on stock 818)
313386
-1
Mael
empty
cross to germline specific Gal4 for tethering Mael to 3'UTR of GFP-reporter (based on stock 818)
; pUASp>lambdaN-HA-Mael [attP40]/CyO; tub>EGFP_5xBoxB_SV40 [attP2]/TM3, Ser;
Sign In to show prices
313388
313388
JB-STOCK
tethering lines
; pUASp>lambdaN-HA-Su(var)205 [attP40]/CyO; tub>EGFP_5xBoxB_SV40 [attP2]/TM3, Ser;
cross to germline specific Gal4 for tethering Su(var)205 to 3'UTR of GFP-reporter (based on stock 818)
313388
-1
Su(var)205
empty
cross to germline specific Gal4 for tethering Su(var)205 to 3'UTR of GFP-reporter (based on stock 818)
; pUASp>lambdaN-HA-Su(var)205 [attP40]/CyO; tub>EGFP_5xBoxB_SV40 [attP2]/TM3, Ser;
Sign In to show prices
313389
313389
JB-STOCK
tethering lines
; pUASp>lambdaN-HA-Gtsf1 [attP40]/CyO; tub>EGFP_5xBoxB_SV40 [attP2]/TM3, Ser;
cross to germline specific Gal4 for tethering Gtsf1 to 3'UTR of GFP-reporter (based on stock 818)
313389
-1
Gtsf1
empty
cross to germline specific Gal4 for tethering Gtsf1 to 3'UTR of GFP-reporter (based on stock 818)
; pUASp>lambdaN-HA-Gtsf1 [attP40]/CyO; tub>EGFP_5xBoxB_SV40 [attP2]/TM3, Ser;
Sign In to show prices
313390
313390
JB-STOCK
tethering lines
; pUASp>lambdaN-HA [attP40]/CyO; tub>EGFP_5xBoxB_SV40 [attP2]/TM3, Ser;
cross to germline specific Gal4 for tethering control (based on stock 818)
313390
-1
empty
cross to germline specific Gal4 for tethering control (based on stock 818)
; pUASp>lambdaN-HA [attP40]/CyO; tub>EGFP_5xBoxB_SV40 [attP2]/TM3, Ser;
Sign In to show prices
313391
313391
JB-STOCK
tethering lines
; pUASp>lambdaN-HA-Gw [attP40]/CyO; tub>EGFP_5xBoxB_SV40 [attP2]/TM3, Ser;
cross to germline specific Gal4 for tethering Gw to 3'UTR of GFP-reporter (based on stock 818)
313391
-1
gw
empty
cross to germline specific Gal4 for tethering Gw to 3'UTR of GFP-reporter (based on stock 818)
; pUASp>lambdaN-HA-Gw [attP40]/CyO; tub>EGFP_5xBoxB_SV40 [attP2]/TM3, Ser;
Sign In to show prices
313392
313392
JB-STOCK
tethering lines
; pUASp>lambdaN-HA-Piwi [attP40]/CyO; tub>EGFP_5xBoxB_SV40 [attP2]/TM3, Ser;
cross to germline specific Gal4 for tethering Piwi to 3'UTR of GFP-reporter (based on stock 818)
313392
-1
Piwi
empty
cross to germline specific Gal4 for tethering Piwi to 3'UTR of GFP-reporter (based on stock 818)
; pUASp>lambdaN-HA-Piwi [attP40]/CyO; tub>EGFP_5xBoxB_SV40 [attP2]/TM3, Ser;
Sign In to show prices
313393
313393
JB-STOCK
tethering lines
; pUASp>lambdaN-HA-CG9754 [attP40]/CyO; tub>EGFP_5xBoxB_SV40 [attP2]/TM3, Ser;
cross to germline specific Gal4 for tethering CG9754 to 3'UTR of GFP-reporter (based on stock 818)
313393
-1
CG9754
empty
cross to germline specific Gal4 for tethering CG9754 to 3'UTR of GFP-reporter (based on stock 818)
; pUASp>lambdaN-HA-CG9754 [attP40]/CyO; tub>EGFP_5xBoxB_SV40 [attP2]/TM3, Ser;
Sign In to show prices