313350

Sign In to show prices
SKU
JB-STOCK-313350
More Information
VDRC Id 313350
Library JB-STOCK
Sub-Category Tagged construct
Status available
Comment BAC construct containg the CG31755 locus with N-terminal GFP-tag; tag inserted at an ATG that was the predicted start codon in a previous FlyBase version (TCAACTGAGGCGATGTACAACGGCG)
Construct Id 313350
Genotype w; GFP_CG31755 [attP40]/CyO; ;
CG Number (r6.01) CG31755
Synonyms SoYb
Sequence empty
Viability unknown