Other Resources
For more information about our other resources, please check out our information page.
For explanations of fields, please checkout out our field definitions.
Shop By
Shopping Options
Name | VDRC Id | Library | Sub-Category | Genotype | Comment | Construct Id | Publication | Provider Scientist | Provider Organization | Gene Symbol | FlyBase gene number | Synonyms | Sequence | RRID | Comment | Gene Name | Keywords | Price (net) | Add to Cart | ||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
312184 |
312184
|
AS-STOCK
|
enhancer reporter transgene
|
w[*]; M{muscle_synth4-lacZ}ZH-51C
|
Synthetic enhancer reporter. Construct 'pBA037 Hsp_muscle_synth4-lacZ_attB' (muscle_synth4) inserted into the attP landing site line M{3×P3-RFP.attP′}ZH-51C via PhiC31 integrase insertion. Insertion site Chr 2, 51C1, 2R:14732515.
|
312184
|
Alexander Stark
|
Institute of Molecular Pathology (IMP)
|
|
|
hsp70
lacZ minimal promoter muscle synth4 synthetic enhancer reporter |
GGGTCTTAAGGCTATTTGAGTGGCGGCGAGATCTCACCTGGCTCTACAGGATCCCAGTTCTGAAAGCGGGCAGGACACGGCCCCCTCGTTCACCTAACAACAGGTGTCGCTCAACTAGGTAACCTGAGTAGGCGAAATTTAGGAACCGGTAGTGTTCAAAAATGTAGGGAGCAGCCTTTTGCGGCGGCTGGCGTTCGGCCGAGAGCTCCCAAGCAACCTCAGAGATCTGCGTCAACTGATTGGCCTTCTAACTCGTCATACGAACAAGAGCGGCAGCGCTATTTTTAGAATAAAAATCTCGAAGTCGGCAGTCCCGGAGAGAAATTAAGAGAACGCACATCGTCCATCTCACATTGACTCACGCCATAGAACCCCTGCGGGAACGGCAACCATTGATGCCCTCTCTAAACTGTTTAGCCTCCATAGTTGCAGGTAGGGATCTGAATGTTTCTCGATAAAGACGATCCGAAGGTATCCCCCTCGTCATTATTCGACTCTAGG
|
|
Synthetic enhancer reporter. Construct 'pBA037 Hsp_muscle_synth4-lacZ_attB' (muscle_synth4) inserted into the attP landing site line M{3×P3-RFP.attP′}ZH-51C via PhiC31 integrase insertion. Insertion site Chr 2, 51C1, 2R:14732515.
|
|
synthetic enhancer reporter
lacZ muscle synth4 minimal promoter hsp70 |
Sign In to show prices | ||||
312185 |
312185
|
AS-STOCK
|
enhancer reporter transgene
|
w[*]; M{muscle_synth5-lacZ}ZH-51C
|
Synthetic enhancer reporter. Construct 'pBA038 Hsp_muscle_synth5-lacZ_attB' (muscle_synth5) inserted into the attP landing site line M{3×P3-RFP.attP′}ZH-51C via PhiC31 integrase insertion. Insertion site Chr 2, 51C1, 2R:14732515.
|
312185
|
Alexander Stark
|
Institute of Molecular Pathology (IMP)
|
|
|
hsp70
lacZ minimal promoter muscle synth5 synthetic enhancer reporter |
GTATGTAGATTATGCGCCGACACGGCCTAGTGAGGTATTAGCCTGAGCAGGGATCATTGGCGATACGGTGGTGCTCCATTAGATCGGACAGGGATACAAGGGCCTGAATCCTCGCCGGAACAGCCAATGTGTGTAGGATCTCTAGAGTGGCCAAGCCGCCTCCGGCGAATCAGGTTACACATATTAGGGAAGTTAATGGTATACCCGATAGCCACTTTCCGCGTGGCCGTGCGGTCTTATTGAAACAGAAGATCTTGGTGTGTGCGGTGCACGGCGCTTAAAAGATAAAAATAGTCACGGGGGCGGATTGGTAGCTACAGAGTAGCTTATACTCATATATTTCTATCGGCGCCACGGTACGAAAATAGATCCATTCGCGAGTCGGGGTTTTCCAATTCCTCCCTCGTAATACGGGGGGCGACTAGCCTCGCGTGCAGTCTCTCTTTGTAACTTTGGTATAAATTTCAGAGCAGGCCGAAAGAAAAGACAGTGGGCCGTCCC
|
|
Synthetic enhancer reporter. Construct 'pBA038 Hsp_muscle_synth5-lacZ_attB' (muscle_synth5) inserted into the attP landing site line M{3×P3-RFP.attP′}ZH-51C via PhiC31 integrase insertion. Insertion site Chr 2, 51C1, 2R:14732515.
|
|
minimal promoter
hsp70 synthetic enhancer reporter lacZ muscle synth5 |
Sign In to show prices | ||||
312186 |
312186
|
AS-STOCK
|
enhancer reporter transgene
|
w[*]; M{muscle_synth6-lacZ}ZH-51C
|
Synthetic enhancer reporter. Construct 'pBA039 Hsp_muscle_synth6-lacZ_attB' (muscle_synth6) inserted into the attP landing site line M{3×P3-RFP.attP′}ZH-51C via PhiC31 integrase insertion. Insertion site Chr 2, 51C1, 2R:14732515.
|
312186
|
Alexander Stark
|
Institute of Molecular Pathology (IMP)
|
|
|
hsp70
lacZ minimal promoter muscle synth6 synthetic enhancer reporter |
AATCTTAGCAGCAGGAATTACGGGCTAATTCTAGACCATGGAGAGGGTATAGACGACTAGCTATGATTACAGGGATTTTAGGCTTCATAGAATCCACGCGGGGCAAAGACACCAGTACATGGGCCGAGCCTACGCCATCACTGTTTCTTCTTACGGCCTTCTAGGTGCTTATTTTCCGCGGATCCCCACAAGTAACGGCCTGGAGAGGAGAACTATTTCAGTAGCCGCTACACAAGGTCTCGATTCCAAAGCTATTAATAGCCGTTGTTTCTCAAACTACGGTGGGTAGGATCGGTTGCGGTGTGAACGGGAGACTAATTTTAAGCAGCGGAGGAGGAGTCTGTCGAGAAAGGTGAGGCCACTGCTAGAGAACATAAAGATCTCGGAGAGCGTCAAATGAGACGTATTTGTAGTAAGTATCGGGAGCCCTATAAGTTCATGGTTAGGGATAAAGATTTTTATAGTCCTACTTAATTTCTAACATACTAAGCAAAAAGACAC
|
|
Synthetic enhancer reporter. Construct 'pBA039 Hsp_muscle_synth6-lacZ_attB' (muscle_synth6) inserted into the attP landing site line M{3×P3-RFP.attP′}ZH-51C via PhiC31 integrase insertion. Insertion site Chr 2, 51C1, 2R:14732515.
|
|
muscle synth6
minimal promoter synthetic enhancer reporter hsp70 lacZ |
Sign In to show prices | ||||
312187 |
312187
|
AS-STOCK
|
enhancer reporter transgene
|
w[*]; M{muscle_synth7-lacZ}ZH-51C
|
Synthetic enhancer reporter. Construct 'pBA040 Hsp_muscle_synth7-lacZ_attB' (muscle_synth7) inserted into the attP landing site line M{3×P3-RFP.attP′}ZH-51C via PhiC31 integrase insertion. Insertion site Chr 2, 51C1, 2R:14732515.
|
312187
|
Alexander Stark
|
Institute of Molecular Pathology (IMP)
|
|
|
hsp70
lacZ minimal promoter muscle synth7 synthetic enhancer reporter |
GGAGTATGGGATCACAAGGTGAGATGTCCACGGGCTTGGTAGGGTGCATATCACTCCGAGAATAGAACAAATCATATATCATAATCGGTCTAGGGCGGTCCAGGGACGCCGCAAAAAAGGCTGCGAATAGCTCGATAGGGAGCAACCCAGTCAAGATACGGATCCTACTATGACGACGTAAAAAGTGGAAACTGAACATGAATATCGTGACAACGAGCAACGCTCGATCAAAATAGCCAGCTCATGACCCCTGCCCCAGGGACTTGCCGCCATCTGTGCCAAAGGAGATTGGAAACTCGAAGAGCTGAACTAAATTTAGCAGAAACATCATGTGTGCCCCAAACCAATACAATTAGGGAGAGTCAGACGCCATCGGTCCAGGCACCCTACTGCAAAGTGATGCCGGAAGAATCCGAATGCGACGTCGTAGTGCGAGTCCATACGTGTCTCATATCGTGCGGGCCGACGTCCAATACTATTCATGGAACTACGGCATTCCAA
|
|
Synthetic enhancer reporter. Construct 'pBA040 Hsp_muscle_synth7-lacZ_attB' (muscle_synth7) inserted into the attP landing site line M{3×P3-RFP.attP′}ZH-51C via PhiC31 integrase insertion. Insertion site Chr 2, 51C1, 2R:14732515.
|
|
minimal promoter
synthetic enhancer reporter hsp70 lacZ muscle synth7 |
Sign In to show prices | ||||
312188 |
312188
|
AS-STOCK
|
enhancer reporter transgene
|
w[*]; M{muscle_synth8-lacZ}ZH-51C
|
Synthetic enhancer reporter. Construct 'pBA041 Hsp_muscle_synth8-lacZ_attB' (muscle_synth8) inserted into the attP landing site line M{3×P3-RFP.attP′}ZH-51C via PhiC31 integrase insertion. Insertion site Chr 2, 51C1, 2R:14732515.
|
312188
|
Alexander Stark
|
Institute of Molecular Pathology (IMP)
|
|
|
hsp70
lacZ minimal promoter muscle synth8 synthetic enhancer reporter |
TTGAACGGGCAAAATGCGAGCTATGCGCATCTACGTGGAGAGATGCCTGGTTCTGGGTGCGTCCGTTCGCTCGACCTGCAATGAGATTCTCGCCGGAACAGTGAACGATGCCAGGGGATCTATCGTTGAAAGAGTTAAGTGCGCCTTAACTGCTGAGCAAGATCTGTGTGGTTGACACTGAGATTCCGCAGGAAACTCTTTTTCTCACAGGATCGGCAGCCGGCGGTAGCCCCGGGCCGGAGGTATTGGCTCACCACGTTTTCAGAAAGACCAGAGCATACTAACTTTGAACTTTCCTGGCTTTCCTATAAGCGATATGCGTTTATAGGCTCCGTCTGTATACACAACTGTCTATAACTGTATGTTTAATGTGGAGCCAGTACTTGCGTTTATTTATAGCGGAATGCACAGAATCTCGAGTTTAGAGCCAAGTCGGGTGAGCCGAATAGTCTACTCTCCAGACTCATGTTAGGGAACGCACTTTCGGCTTCAGCCACCGAG
|
|
Synthetic enhancer reporter. Construct 'pBA041 Hsp_muscle_synth8-lacZ_attB' (muscle_synth8) inserted into the attP landing site line M{3×P3-RFP.attP′}ZH-51C via PhiC31 integrase insertion. Insertion site Chr 2, 51C1, 2R:14732515.
|
|
muscle synth8
hsp70 minimal promoter lacZ synthetic enhancer reporter |
Sign In to show prices | ||||
313801 |
313801
|
JB-STOCK
|
tagged construct
|
w; ; 3xFLAG_V5_Precission_GFP_smt3 [attP2]/TM3,Sb;
|
Pacman CH322-158C23 containing the smt3 locus with N-terminal 3xFLAG_V5_Precission_GFP; Glycerol #915
|
313801
|
|
|
|
|
|
SUMO
|
empty
|
|
Pacman CH322-158C23 containing the smt3 locus with N-terminal 3xFLAG_V5_Precission_GFP; Glycerol #915
|
|
|
Sign In to show prices | |||
310601 |
310601
|
FB-STOCK
|
tagged construct
|
w*; me31B[KI.mTomato]
|
The mTomato sequence was inserted via Crispr/Cas9 in the me31B locus, at the C-terminus of the me31B coding sequence, using the strategy described in Kina et al., 2019 (DOI: 10.1111/dgd.12607). No selection marker was used. Phenotype: white eyes, larvae mTomato positive. This line can be used as a P-body marker, but not to assess granule material properties. It contains a 12 aa deletion at the end of Me31B coding sequence and the mTomato tag may affect granule material properties.
|
310601
|
Florence Besse
|
Institute de Biologie Valrose (iBV) (http://ibv.unice.fr/)
|
me31B
|
|
C-terminal mTomato tag
DDX6 Dhh1p/Me31b DmRH3 ME31B Mat31B Maternal expression at 31B Me31B Me31b P-body marker knock-in l(2)k06607 mTomato maternal expression at 31B me31B me31b |
see publication
|
|
The mTomato sequence was inserted via Crispr/Cas9 in the me31B locus, at the C-terminus of the me31B coding sequence, using the strategy described in Kina et al., 2019 (DOI: 10.1111/dgd.12607). No selection marker was used. Phenotype: white eyes, larvae mTomato positive. This line can be used as a P-body marker, but not to assess granule material properties. It contains a 12 aa deletion at the end of Me31B coding sequence and the mTomato tag may affect granule material properties.
|
maternal expression at 31B
|
knock-in
C-terminal mTomato tag P-body marker mTomato |
Sign In to show prices | ||||
310602 |
310602
|
FB-STOCK
|
tagged construct
|
w*; ; rin[KI.mCherry]
|
The mCherry sequence was inserted via Crispr/Cas9 in the rin locus, at the N-terminus of the rin coding sequence, using the strategy described in Kina et al., 2019 (DOI: 10.1111/dgd.12607). No selection marker was used. Phenotype: white eyes, larvae mCherry. Rin is the Drosophila ortholog of the G3BP1; it is Stress Granule marker positive.
|
310602
|
Florence Besse
|
Institute de Biologie Valrose (iBV) (http://ibv.unice.fr/)
|
rin
|
|
N-terminal mCherry tag
Next to squid Nts RIN Rasputin Rin Stress Granule marker cg9412 knock-in mCherry rasp rasputin rin |
see publication (Formicola et al., 2021; doi: 10.7554/eLife.65742.)
|
|
The mCherry sequence was inserted via Crispr/Cas9 in the rin locus, at the N-terminus of the rin coding sequence, using the strategy described in Kina et al., 2019 (DOI: 10.1111/dgd.12607). No selection marker was used. Phenotype: white eyes, larvae mCherry. Rin is the Drosophila ortholog of the G3BP1; it is Stress Granule marker positive.
|
rasputin
|
Stress Granule marker
knock-in N-terminal mCherry tag mCherry |
Sign In to show prices | ||||
310603 |
310603
|
FB-STOCK
|
tagged construct
|
w*; ; Patr-1[KI.mTomato]
|
The mTomato sequence was inserted via Crispr/Cas9 in the Patr-1 locus, at the C-terminus of the Patr-1 coding sequence, using the strategy described in Kina et al., 2019 (DOI: 10.1111/dgd.12607). No selection marker was used. Phenotype: white eyes, larvae mTomato positive. Patr-1 is the Drosophila ortholog of PATL1; it can be used as a P-body marker.
|
310603
|
Florence Besse
|
Institute de Biologie Valrose (iBV) (http://ibv.unice.fr/)
|
Patr-1
|
|
BcDNA:LD27979
C-terminal mTomato tag HPat HPat1 Hpat LD27979 P-body marker Part-1 Patr-1 Protein associated with topo II related - 1 anon-WO0118547.282 hpat knock-in l(3)06442 lethal (3) 06442 mTomato patr-1 |
see publication (Formicola et al., 2021; doi: 10.7554/eLife.65742.)
|
|
The mTomato sequence was inserted via Crispr/Cas9 in the Patr-1 locus, at the C-terminus of the Patr-1 coding sequence, using the strategy described in Kina et al., 2019 (DOI: 10.1111/dgd.12607). No selection marker was used. Phenotype: white eyes, larvae mTomato positive. Patr-1 is the Drosophila ortholog of PATL1; it can be used as a P-body marker.
|
Protein associated with topo II related - 1
|
C-terminal mTomato tag
P-body marker knock-in mTomato |
Sign In to show prices | ||||
310800 |
310800
|
AD-STOCK
|
Tagged Construct
|
y[1],w[1118]; P{CG10068-GFP}
|
CG10068 (orthologous to human Elmod) tagged at N-terminal with GFP under Ubq promoter. Construct inserted in genome via P-element integration.
|
310800
|
Alexander Dammermann
|
Max Perutz Labs, University of Vienna
|
CG10068
|
|
Elmod-GFP
GFP N-terminal Ubq promoter tag |
|
|
CG10068 (orthologous to human Elmod) tagged at N-terminal with GFP under Ubq promoter. Construct inserted in genome via P-element integration.
|
|
N-terminal
tag Elmod-GFP Ubq promoter GFP |
Sign In to show prices | ||||
310801 |
310801
|
AD-STOCK
|
Tagged Construct
|
y[1],w[1118]; P{CG10068-GFP}
|
CG10068 (orthologous to human Elmod) tagged at C-terminal with GFP under Ubq promoter. Construct inserted in genome via P-element integration.
|
310801
|
Alexander Dammermann
|
Max Perutz Labs, University of Vienna
|
CG10068
|
|
C-terminal
Elmod-GFP GFP Ubq promoter tag |
|
|
CG10068 (orthologous to human Elmod) tagged at C-terminal with GFP under Ubq promoter. Construct inserted in genome via P-element integration.
|
|
C-terminal
Ubq promoter Elmod-GFP GFP tag |
Sign In to show prices | ||||
310802 |
310802
|
AD-STOCK
|
Tagged Construct
|
y[1],w[1118]; P{nmdyn-D7-GFP}
|
CG8362 (orthologous to human NME7) tagged at N-terminal with GFP under Ubq promoter. Construct inserted in genome via P-element integration.
|
310802
|
|
Alexander Dammermann
|
Max Perutz Labs, University of Vienna
|
nmdyn-D7
|
|
CG10068
GFP N-terminal NME7-GFP Ubq promoter nmdyn-D7 tag |
|
|
CG8362 (orthologous to human NME7) tagged at N-terminal with GFP under Ubq promoter. Construct inserted in genome via P-element integration.
|
nmdyn-D7
|
Ubq promoter
N-terminal GFP tag NME7-GFP |
Sign In to show prices |