Other Resources

For more information about our other resources, please check out our information page.

For explanations of fields, please checkout out our field definitions.

Name	VDRC Id	Library	Sub-Category	Genotype	Comment	Construct Id	Publication	Provider Scientist	Provider Organization	Gene Symbol	Synonyms	Sequence	Comment	Gene Name	Keywords	Price (net)
310816	310816	AD-STOCK	Deletion	y[1],w[1118]; ; CG8138-delta	CG8138 (orthologous to human CFAP299) deletion created via CRISPR using 2 guide RNAs. Deletions confirmed by PCR.	310816	Dobbelaere et al., EMBO J (2023)	Alexander Dammermann	Max Perutz Labs, University of Vienna	CG8138	CFAP299 CRISPR deletion		CG8138 (orthologous to human CFAP299) deletion created via CRISPR using 2 guide RNAs. Deletions confirmed by PCR.		CFAP299 CRISPR deletion	Sign In to show prices
310817	310817	AD-STOCK	Tagged Construct	y[1],w[1118]; P{CG10137-GFP}	CG10137 (orthologous to human CEP104) tagged at C-terminal with GFP via pUBQ-vector and gateway cloning. Construct inserted in genome via P-element integration.	310817	Dobbelaere et al., EMBO J (2023)	Alexander Dammermann	Max Perutz Labs, University of Vienna	CG10137	C-terminal CEP104 GFP P-element insertion pUBQ vector tag		CG10137 (orthologous to human CEP104) tagged at C-terminal with GFP via pUBQ-vector and gateway cloning. Construct inserted in genome via P-element integration.		tag CEP104 P-element insertion GFP pUBQ vector C-terminal	Sign In to show prices
310818	310818	AD-STOCK	Tagged Construct	y[1],w[1118]; ; P{CG10137-GFP}	CG10137 (orthologous to human CEP104) tagged at C-terminal with GFP via pUBQ-vector and gateway cloning. Construct inserted in genome via P-element integration.	310818	Dobbelaere et al., EMBO J (2023)	Alexander Dammermann	Max Perutz Labs, University of Vienna	CG10137	C-terminal CEP104 GFP P-element insertion pUBQ vector tag		CG10137 (orthologous to human CEP104) tagged at C-terminal with GFP via pUBQ-vector and gateway cloning. Construct inserted in genome via P-element integration.		GFP C-terminal P-element insertion pUBQ vector CEP104 tag	Sign In to show prices
310819	310819	AD-STOCK	Deletion	y[1],w[1118]; w+-CG10137-delta	CG10137 (orthologous to human CEP104) deletion generated by Flp‐FRT recombination between two transposon elements flanking its coding sequence (Parks et al, 2004): PBac{RB}CG10137e00472 and PBac{WH}CG10137f04546. This results in white+ eyes.	310819	Dobbelaere et al., EMBO J (2023)	Alexander Dammermann	Max Perutz Labs, University of Vienna	CG10137	CEP104 CRISPR deletion		CG10137 (orthologous to human CEP104) deletion generated by Flp‐FRT recombination between two transposon elements flanking its coding sequence (Parks et al, 2004): PBac{RB}CG10137e00472 and PBac{WH}CG10137f04546. This results in white+ eyes.		deletion CEP104 CRISPR	Sign In to show prices
310820	310820	AD-STOCK	Tagged Construct	y[1],w[1118]; P{CG14551-GFP}	CG14551 (orthologous to human CFAP97D1) tagged at C-terminal with GFP via pUBQ-vector and gateway cloning. Construct inserted in genome via P-element integration.	310820	Dobbelaere et al., EMBO J (2023)	Alexander Dammermann	Max Perutz Labs, University of Vienna	CG14551	C-terminal CFAP97D1 GFP P-element insertion pUBQ vector tag		CG14551 (orthologous to human CFAP97D1) tagged at C-terminal with GFP via pUBQ-vector and gateway cloning. Construct inserted in genome via P-element integration.		CFAP97D1 pUBQ vector P-element insertion C-terminal GFP tag	Sign In to show prices
310821	310821	AD-STOCK	Tagged Construct	y[1],w[1118]; P{CG14551-GFP}	CG14551 (orthologous to human CFAP97D1) tagged at N-terminal with GFP via pUBQ-vector and gateway cloning. Construct inserted in genome via P-element integration.	310821	Dobbelaere et al., EMBO J (2023)	Alexander Dammermann	Max Perutz Labs, University of Vienna	CG14551	CFAP97D1 GFP N-terminal P-element insertion pUBQ vector tag		CG14551 (orthologous to human CFAP97D1) tagged at N-terminal with GFP via pUBQ-vector and gateway cloning. Construct inserted in genome via P-element integration.		pUBQ vector N-terminal GFP tag P-element insertion CFAP97D1	Sign In to show prices
310822	310822	AD-STOCK	Deletion	y[1],w[1118]; CG14551-delta	CG14551 (orthologous to human CFAP97D1) deletion created via CRISPR using 2 guide RNAs. Deletions confirmed by PCR.	310822	Dobbelaere et al., EMBO J (2023)	Alexander Dammermann	Max Perutz Labs, University of Vienna	CG14551	CFAP97D1 CRISPR deletion		CG14551 (orthologous to human CFAP97D1) deletion created via CRISPR using 2 guide RNAs. Deletions confirmed by PCR.		deletion CRISPR CFAP97D1	Sign In to show prices
310823	310823	AD-STOCK	Tagged Construct	y[1],w[1118]; ; P{Erk7-GFP}	Erk7 (orthologous to human MAPK15) tagged at C-terminal with GFP via pUBQ-vector and gateway cloning. Construct inserted on chromosome 3 via P-element integration.	310823	Dobbelaere et al., EMBO J (2023)	Alexander Dammermann	Max Perutz Labs, University of Vienna	Erk7	C-terminal CG17441 CG2309 ERK ERK7 Erk Erk7 Extracellularly regulated kinase 7 GFP Mapk15 P-element insertion erk pUBQ vector tag		Erk7 (orthologous to human MAPK15) tagged at C-terminal with GFP via pUBQ-vector and gateway cloning. Construct inserted on chromosome 3 via P-element integration.	Extracellularly regulated kinase 7	tag P-element insertion Mapk15 C-terminal GFP pUBQ vector	Sign In to show prices
310824	310824	AD-STOCK	Tagged Construct	y[1],w[1118]; P{CG6664-GFP}	CG6664 (orthologous to human CCDC6) tagged at C-terminal with GFP via pUBQ-vector and gateway cloning. Construct inserted on chromosome 2 via P-element integration.	310824	Dobbelaere et al., EMBO J (2023)	Alexander Dammermann	Max Perutz Labs, University of Vienna	CG6664	C-terminal CCDC6 GFP P-element insertion pUBQ vector tag		CG6664 (orthologous to human CCDC6) tagged at C-terminal with GFP via pUBQ-vector and gateway cloning. Construct inserted on chromosome 2 via P-element integration.		pUBQ vector GFP CCDC6 P-element insertion C-terminal tag	Sign In to show prices
310825	310825	AD-STOCK	Tagged Construct	y[1],w[1118]; ; P{CG6664-GFP}	CG6664 (orthologous to human CCDC6) tagged at C-terminal with GFP via pUBQ-vector and gateway cloning. Construct inserted on chromosome 3 via P-element integration.	310825	Dobbelaere et al., EMBO J (2023)	Alexander Dammermann	Max Perutz Labs, University of Vienna	CG6664	C-terminal CCDC6 GFP P-element insertion pUBQ vector tag		CG6664 (orthologous to human CCDC6) tagged at C-terminal with GFP via pUBQ-vector and gateway cloning. Construct inserted on chromosome 3 via P-element integration.		tag C-terminal GFP P-element insertion CCDC6 pUBQ vector	Sign In to show prices
310826	310826	AD-STOCK	Tagged Construct	y[1],w[1118]; P{Erk7-GFP}	Erk7 (orthologous to human MAPK15) tagged at C-terminal with GFP via pUBQ-vector and gateway cloning. Construct inserted on chromosome 2 via P-element integration.	310826	Dobbelaere et al., EMBO J (2023)	Alexander Dammermann	Max Perutz Labs, University of Vienna	Erk7	C-terminal CG17441 CG2309 ERK ERK7 Erk Erk7 Extracellularly regulated kinase 7 GFP Mapk15 P-element insertion erk pUBQ vector tag		Erk7 (orthologous to human MAPK15) tagged at C-terminal with GFP via pUBQ-vector and gateway cloning. Construct inserted on chromosome 2 via P-element integration.	Extracellularly regulated kinase 7	P-element insertion pUBQ vector GFP C-terminal Mapk15 tag	Sign In to show prices
312158	312158	AS-STOCK	gene knockout	w[*];; CG11247[indel1]/TM3,Sb;	A single nucleotide deletion in the first exon of CG11247. Created via gRNA + Cas9 injection.	312158	Hofbauer et al., Molecular Cell (2024)	Alex Stark	Institute of Molecular Pathology (IMP)	CG11247	CG11247-knockout	GATTACGTGCAACCGCAG-TTAAGAAGTCTGCCCGAAAGGGCGAACCGGTG	A single nucleotide deletion in the first exon of CG11247. Created via gRNA + Cas9 injection.		CG11247-knockout	Sign In to show prices