Vienna Tiles GAL4 Library

For more information about our Vienna Tiles GAL4 Library, please check out our information page.

For explanations of fields, please checkout out our field definitions.

View as Grid List

Items 49-60 of 200

Set Descending Direction
Name VDRC Id Library Sub-Category Genotype Construct Id FlyBase gene number Synonyms VT ID Nearest Genes Distance Transcriptional Activator Left Primer Right Primer Insertion Site Template Sequence Length Link to FlyBase Link to Resources Link to UCSC Genome Browser FlyEnhancers BrainBase Sequence Verification Status FlyBase Reference Reports RRID Comment Price (net) Add to Cart
200965
200965
VT-GAL4
257224
BcDNA:RH11383
CNB
Calcineurin B
Can
CanB
CnB
canB-4F
dCnB1
57224
GAL4
CGATTGGGATTGTTCGCATCATCTT
CTAAATGCCAGAGCCCATAAGCCCA
attP2
genomic
2237
VT57224
53338
CGATTGGGATTGTTCGCATCATCTTAAACTAGTTTGTACTATATCCTAAACTCTACGTTCAATTCAAGCCTAACACTTAAGTTCATCTCTCGACTAAATGTTGTGTATAAGATATGTAAAAAAATCAAAAAAAAAAAAAAAAAAAAAATTGACAAAAGAAAACTACAACAACAACTACAATTAAACACTGTTTATCGCAAAGCTAAACTCAAAACCCCCAACAAGCGTTTACTTGGTGATTTTTCGTTGTACTACCACTATCTGTTGATGGGAGGTGGACGAATGTGGGCTGGGTTCTTTGGCCGGCGGGTTCAGATGCCCTCAGAGTTCCACGGTCCGCGAGTCCTTGGACGAAGAACACGTGCGTGTCGTTCAGCTCGGCGCCCGAAATTCCGGATTCCCGAAAGCCGACCCCGTAGAAGATGGTCACCACAAAATGTGGGAAGGAAGCCACCGGCCGAAAGTAACCGAAAACTTTTTGGCCGTTGGCAACGATTAAATGTTTTGTAGGTCACCGATTTTCCAACTACACGTGTGTGTGTGTGTGACGTCCCTCATGTGACAAGACACACCAACATACATGTTACGTATACGCCACGTTGTTTAGAACAAAGCAGTGGAAGAAGTTCATCCATGTTGAGATTAAAATTACCTTAGTATAGAGCAGAAATGTCACAAATGAGTGGGAAAAGTTTATCCATTGATATAAAACATCTATCTACTAATGAAACATAAATATTACGTATACGCCACGTTGTTCAGTACAAATTTGCGAATGCGGAGCCTTCCTGTGGATTTAAAATAGAACATAAATATCGCAAAGCATTAAGAGATGATAATCCATGTTGATATAAAACACTTAAAAAAATGTTACGTATACGCCATGTTGTTCAATACAAATCAGTTGGAGAAGATCATCCCTGCTGCCGCAGAATACTATTTTATATATTTCCCACATTTTTGGTACCGAACTCAACAAGAATTTCTCGCAGTGTGGACAACAGGAAGCCAGCCAACTAGCTGTTGGGTCCGCGTAGAACTTGTACGGTAACAGAGCCTTGACCACGGAGTCACCTGCTGGGCGATTGGGCCACAGTATTAGTGAACTAGGGAGGTCCTGCGAGGGTCCTTTGTGTGCGCCAGTGTGCGAGAATGCGTGAGTGTGTGTGCGTGGTATCAATAAATTATTATATGCTGTCTGTCGCAAGCTGGTTCGTTAATCATTTTCGCCTGGGCCCTGCCCCCCGCCCCCTGCCACCTGCCCACGCTTCGAATCCGACCTCCAAATGAAGGCATTTCCATTTTGAAAATTAGTAGGGTTAATGCTGAAGTTACACCCGTACACCCGTATACCCGTACACACGATTCCCAAGGAGCAACCTGCAGCCCACTAATTTCGCTCCTGTTGCTGCGTCACGAGCCCACGGTTTGACCTTTTTCCGATTGCTATTAATTGGTTTGATTAATGTGCTCCAATTTTCGGATGGTACGTAATGTCGCCGGTCCCCAATAATCGAGCATTTCCATACCGACCAATGCGTCCATCATTTCATTCACGGGACTTGTATTAATCGATGGGCCATACATACAATTTGTTACTTCGATGGGTTTTTCGAATGGGACAGGTGATATATACATTTATATATTTCCGGGCACGGCGAGGAGATGATCAAGTTTAGATAATAGCATAATATATGTATATCTGCGCTTCGGGCAAATATTATTCAATTTTCTATCGAAAGATTACCGGTCGGTCATTGATGTCATCCCAAAATCTGAGGCACCCCCATCTTGCCACAAAACCTATTGATCCCTTTTTTTGTATTTGTGTGTGTTTTTTTTTGTTTTTGTCTCCGTTTATTTTTGGATACCTTTTTGCCGCTTCTGTTGGCCGAAGTTGCCTCAAACTTATTTCGCTTGAATAACTTCGTTTCGGTGGCAACTATTTAGTCAAACGGGTTTTTATAAATTATGCATGTACAGAAATTCTCCCAATTTTAATGGGCTGGCGAGCGAAGAAGGGAGGGGGTATATACCTGTTTACCACCAACACAAATCAATATACCTCATATATACTTTCATACATATACACATATATATATTTATATATCATGTGTGTGTAATGGAGTTCGGACAGGTTAGGGATATCGCATAGCCTCCAAACGAAATTGTCAGCTTTCATTCCGCATAGTCCTTGGCCAACCGAAATCTCTGGGCTTATGGGCTCTGGCATTTAG
verified
Sign In to show prices
200970
200970
VT-GAL4
257244
BcDNA:GM01744
CG12733
CG4179
SK
Sk
dSK
small conductance calcium-activated potassium channel
57244
GAL4
CAAACTAACCGCATTCACTCCCAAA
GGGCAACGGAAAAGGAGGGAAAATC
attP2
genomic
2295
VT57244
-200970
CAAACTAACCGCATTCACTCCCAAAAAAAAAAAAAAAATATGAGGCAGAAGAAAAGAAATGTTACAGAAATGGGGGAAACCCCCCCATTCCATCAACTGACCAAATTGTGCACTCAGGGTGAACTAATTGAGTAATTCAAAGTTTTTAGGTCCCAAATACACAACACACATACAATTGCACTGAGAGAAACGTGTCGTTCTTGCTCTACTTTAGGTGATTACTTATATTCAGCATATTAAATAATCCCTGCAATTATTTCTCTGCTAAACATAAAAAGTTCCTATTAATTAAAATAACTGGGAAGGATTGCTGTATAACTCATTTCATATGCTTTCTTTTTTTTTTTTTTAATCGAATCAGAAACTCGCTTTCCTTGTGCTGTAAAAATTTCTGAGGGTGCGCTGCAGGGCAGGGCAAAAATATTACTTATCCGCCTAATTAAGCTCCAACAAAGCGAACACTTCATTATATATTTCCTGCACTCCGGCTGGCACAGATTGGAGATGGATGTGGAGTGGTTAGGGTTGGTGCGGGGAACGGGGCAGAGAGGGGCGGGTAAATTTCCTGGCGAGGAAAAGAAAACGTAACCTTAATGTAATGTGAATTACGCTAAATTTATTAGGCAACAATGAGTTAGCAGAGTGGGGGGGAAAGCGAAAACGGAAACCCAGGCAAACCGAAAAGCGAGGGGAAAACTCTCACGAGCCCACACACACACACACACACGCAGACTCACATACACACACACACATGAGGCTGAGCCTAATCGTCATCGTTAACTCCGACTTCAGGACCTCTTCACCCTGGATTTTCCAACCAGTCGTTACCAATTTCGTCGCTTGTTTCGTATTTTCTCTCCTAGTTTCGTTTCCTTTTTGCGTGCTGGCCGCGTTTTGTATAGGAAACTCGATAATTTCCACCAATTTCCTTTCGCTGCACATGCGTGTGTGTGTGTGTGTGTGTGTGTTAGCCCTGTTAGCTGGCAAAGTATGCGTGTCCATGCGAAGCTCATAAACTCTGTGTCGGCAATGAGTATGTTAATTTGGTTAGAGGTGAGAACGCAGGTGAGAAATAATTTCGGGGCGTGGCAACGGCTAAATGCCAATGGCAACAACCCATCTCTTTTGTGTGCGTGATCGGCCAGAGGACAAAAACAACAACAACAAAAGCGAAGGGGGGTGAAAAACAAAAAAAAACTAGAAGACAGATAAAATTGGGGCCAACATGGGGTTGGGCACCAATCGAAATTACTTAACCAAGTACTTCAAACAACAAACAAAAGTTTGCCGCAAAAGACGCAAAATTACCCAACAAAATTACACTCTTGCCAAAAACTTTGCAACCCGTTAATTCCACTGTTTGTAAACTTAGTTGACAAAGACTTAAATGCCAATTTATCAGGAATTTACGTTTATGTAGTTAGTTGGTTTAAAGTGTGTGAAGCACGCACACAAAAGTGTCACTTAAATGTTGGCTATGGAAATGGCTTAATGGAGATTTTCTAAATATTTATTAAATGTATTATGAAACAAAAAAAAATCAACAAGAAATGTTCAAAATAGGTTGTCATGTTGTCCATTTCGGCTGCACTAACCTCATGTTCATTTGGCCCTCGGCTAATTTTATTTAGTGGCCACAATATTTGATTGTATAGATTTTAAAATTTGATTATGTTTTGTTTAGGCACACATGAATTTTGGGCAATTCCAATAGATTTAATTGAATTCCACGAGTGGCGAATAATATGTTTTTCGGTATTGTTGAAATGCCATCAACGTTTTATAAGTTATCCTATTCATAACATTCCGCATTTGAAATTCCGTGTAAATTGAATTTTCCTGCTATTTTATTCTTCGATGGCTTTTCATTTCACTCCACTTCACTAAATGCGTTTCTCGTCGTTTAATTTATGCCCAATGGTCGCGCAACTGTGAGGCACTCAAAAGAGCTTATTTTCTCGCTCCAGAACTTGCAACATTTTCAAGTTAAATGACTTCCTTTGGGGCATTTATTTAATCTGCTCCTTACCGTTTTATTTTTTTTTTCTTGGGGTTTTCCTCCTCCCGTTTCGCTTTTCAACTTAATTAAGAAATCCAATTAACATCATTGACATTAGATGTCCTAGAATATGCGCAATTTGTTTTGTCTTTATACACATATATATATATAAATATATATGTATATATTGTTTCTTTTTTATTTCGTTGCTGTTCTCACGAGCAAAATACACACACTGACATACAAATGTTCACGCATCTGCCGAAAAATAGATTTTCCCTCCTTTTCCGTTGCCC
verified
Sign In to show prices
200972
200972
VT-GAL4
257247
BcDNA:GM01744
CG12733
CG4179
SK
Sk
dSK
small conductance calcium-activated potassium channel
57247
GAL4
AATAAGTTGCAAAATACAAACGAACGGATG
CACAAGGCACTATTTTTCCATTTGGTTATTT
attP2
genomic
2133
VT57247
53363
AATAAGTTGCAAAATACAAACGAACGGATGGTAAAGTATATGAATGCGATTTAATTTGCATAGCTATTCACCAAATGCTAGTCGCTTAAGCACTCAAGCACTCAAGCAGTCCAGACACAAACACCGTTTGATTACTTATTGAAATTCAATCTATTGATAATGGTCTAATAGTTAAAATATATACATTTTAGCTCCGCAAACCGGCGTCGACACTCTCAATTCCTGGCTCGATGAAAACACCTTCCATTGCGAACCGGGAACAGATCTCATCTGGATGCAACGAAGAAGCGGCCGAGGCACTAGTGGGTATCCACTCAGACTACCCTAGGTATGAAATGTATGTATAGCCCGATCCGAACCGCCAGTAGAGTACGTATCCACAGCAGCGTGCATTCATTAGCATATAGCCCCCAGCCCCCAGCTCCCCCCAATCCACGAAACCACGCCCATTCAAACAGCTCCAACTCCATCTAGAGTTCGTATCCAAACTGATTTGTTGCACCCTTTCCATACCCAAGGAAAGCAATGCGATGTAAAAGAAAACGCTATACGTTTGTACAAACATACAGAAGTGATATGCATTTGATATAGATGGAATGAATATAAATTAGAATAGCGAATTCTATTTTCGCTCAGTGTGTGCCGCATAGAGAAGGTGTAGTGCCACCGAATGGAATGCCACCGAAGTGGGCGATAACGATAACCGTAACTGTGCGCAAATCATTGACTGATGGATGGCCCGGGGACAGTAATTAGCTGTCAATGGCAGGACAAGTGACCCCGGCAATGATGATTTGGCGAGGGCAAAAATGGAAATGGGGCAAATGTCCGGGTAATATTCATTGGGGAGTGCTTGAGCAGAGTCCACGCGATTCAATTTAAGCACTCTAAAGTGAATTCCGCTCACGAATGGATTCTGCGATGGTCCTGCCGTCCTGGGGCCAACATAAATCTCAATGAATGTCATGGATGGCAAGATATTTTCCTGCAATCACGTTGGCAATTTGGCACAGTTCAGCACTTTATAGAGGGGGGCCAGCAAAAAGACGGGGGATTGGATATATGGCTATGGACTGCGATTGTGAATGTGAATGTGAATGTGGCTATATGGGCATCGAAAACGAGGAAAGCCAGCTGTGTGTATGTTTTCATTTGTCAGCAAAATTTTTATTGGCCATCTTTGGCTCATCGAAAGAGCTGGGGCTTACCCCCAACCTTCTGCTCCTTCCTCCTTGTCATCGGTTGCTGTGTATCTATAAGATACAAATTGATATGACACATTTAGGAAAGCCGGAGCAAAGCGAAAACACACAAATCTGTCATTCAGGCTGCAAGATTTATTAAGGTGCCGACTAGAGTTGAACGGATCTGAGTTGGATCCGCTCGAGTTGAGTTCCCTTGAGTTGGGTTGACTTAACCCCCGGATACCCCGATAGTGCCACGTGAAATCTCGACAGCGTCAGCCACTCGAAGCATTAGTCAGCGATCTGTGGAAAGCAATTAAGGGGGGAGGGGGAGTGAAAACCTGTGAAAATTAGTGCGAAAATGGATCAGGACCTTGGAGCAAATCCCTTTGTTACGCTTTTATTTATTTAGCACGGAATTAGGGATATTTCATTCAAGGAACACAAAAAAAAACTAATCACAAATATGATGCGAAAGACAGGCTTAAGGCAAATTATGATAAAGCACGCTGAAAAGTGCCGAAAGGTAAACGATAATAATAATTAGTTCCTGCTCAATCAGCAACATTGTTTTCCCCATCTCGAAATTAGCTTAACTATAGCATATTCTCATTCTTAAAATTCAATGTAAATGACATCAAGCGCATACCAATTAGTAAACCAGGCTCATTAGTAGACTAAAAATAAATAAATGGACCATCACAAGTAGCTTTTGATTTCAATCCCTAAATAGCATCATTCATGGCAGGGAATTAAAATAGCTTAACTGGACGGACACGTTTAAACATTCTATACACACACATCTAATGAATGGTAAAAACGTTGGAAAAATAAATGAAAAATCACGGCATCAAAGAAAATAAACAAGGTGTGAAAATGCAGTCAAAGCATCAACATGAGATTAAATCAAAACAAAAAAAATAACCAAATGGAAAAATAGTGCCTTGTG
verified
Sign In to show prices
200977
200977
VT-GAL4
257465
57465
GAL4
AGTTGCTCCTCCCGCTCTTTCTGC
ATCCTCGTTAACCTGCATCCTGCCC
attP2
genomic
2125
VT57465
53603
AGTTGCTCCTCCCGCTCTTTCTGCACCTCCTGCTCCGCTTCCAGTTTCACTTTGCCCGGCATCCGCCTGCGAGTCACCCACAGCACCACCCACTCAAGGACGCGTCCGGCGAAGGCCGACCAGCAGACACAGAAGGCAGTGCCAAAGAGAGACGTAAAAAAGGAGGAAAATCGGAAGAAAAAAGCAGCCTATCCGACCTTGAGCTGCATTCACCTACCGCCATTTGGCCATCACCCATCACCGCCATCACCGACAGGCGCCCAACTATTTCGCACATCAAATCATAATTTATGGACGGCAATCAAAATGAGCCTGAATTCCCATTCCATTCCATTTTTTTTTTTTTTTTACATTTCGGTTATATTTGATGATGGCTTGGGCTGGTGCGAAAAAGTTGCGCAGTCGCCCACATAATTATCGGTTTGATTTATGGCAGCATTTTCGCAGCCAATTACTTCGCACCAGCTGAAACGTAGGGGAAAAAACGGAACCGGAAGTTCAAATGAACCACTGAGCGAGCGCATATCGAATCCTTGGCAGCTTACCTATCTACAATATATCCTTGGCCATATTGCCACCAAAAGAGCCCCGCTGATTGTGATCTCCTGTTGGCCTGGCCAACCTTGAAGTCAGTCAAAACTCGCTGTGAATGCCCATGATGATTTTGTGAGTTGCATGCAGTGCCTGAAGGACATTCAGTCAGGACATTCAAGTGGAGAAAAGAAAAAAAGCTTTCAGGCAAACAAACTGCCATGCAATCGAATTTTGTTCATACAAATTTTGTTGTGCCTTACTTTACATACATATTTGCATAGTTTACAGTGTAGAGAAATTAAATGAGTCCTCTAGACCCGGTTGGCAATCCAGCAGGACATTAACAAAGTTGGCGCCCAGCGCACAAAAAGACAAACAGACAAAATGGACAAATAGACAAACAGAATGACAGATGGACAGAGTCGGATAAACAGATGGACCATCAAATGGTTGACACACACGTATATATCTTCGCCGAGCAAGGACAATGGGAACCAGGTCAACTGGGGCACAGAGGTGAAGGCAAAAGAGTCGACAGCCAGCTGCCAACCCGAAAATTTTCACCGAACCTGAAGGCTTAAGTGGGAAATGCTGGTTAAGCTCGATTGCCATGGAAATGTATGCTTTTTTTTCTGCTGCCATTTTCGGGCATTTGGCCTTGTTGAATTTGAATACTCACCGAATGTGTACGAAAAGAAATATAATGCCACACATATGATGACGTGTTAATTTTGCTTAATTTATGAAATTAGCAACGTTCTGACTACGAGTTTTCAACACAAAATTGCGGACTATGTTTCGGCTTTTCCTCTGTTCCTTTCGATGGAAGGAACTTTTGTATAATTGCGTTATCTGCTCCACACCCCGACCATTGAAAAGTTGAAAAGTGTTTGCATTCAGCTTCATCAGCTGATTGCCGGCAGGTTCAAAGCATCAAAGCGAAGAAGGCAAACTTTCAGGGGGGGGAATGCGAAATGGGGAAAATGCGTCAGTTAGTCGAGTTGAGGTGTGTTGACACATCGTTTAGGCCAATTTGCGAATTTTGTTGCAAATCTGCCAGAGACTTCATTTTCCAAAAGTCTTGCATATGAGAACTTGATTTCCTTTTCAACACTTCTGTTCCAAATATTATGTGAAACATACATAGAATAAGTATGGACAGATATCACATTGAAACACCTCGTCCTCTAAGGTATTTCGACTGCATAAACTAGCCAGGCGAGTCAATTTCATTCCCTATCGAATGCCAAATGACTTTATATATAAATTAATTATTTCTTAGTCCCACGACCGCCGAGTGGTTAACCCGATTAGAAATACAGTCCATTCGCATACGCAATGGCGTCGGGAATTCGAAATTGGAAACTGCAAGTCGGAATGCATCGGCAATGTTTGCGCTGCTCTGTGGTCGTCGGTTGTGCTGCAATCCTCGAATGTTGACAAACGTAATTAAGAAATTGTTAGGCCCGTCAAATGGCAGGGGGGGGGGGTGGGGGTTAGTTGCACAAATGTTTGCCCACCGCAATGGATGCCCCATAGATATCAGATACTGCTGTGTGCGTCTGTGGGCAGGATGCAGGTTAACGAGGAT
verified
Sign In to show prices
201032
201032
VT-GAL4
217247
BcDNA:AT23078
17247
GAL4
CGCAGCGTTGACGAGTGTTAAGCAT
TTTGCAGGAACTTCATTGCAGGGAC
attP2
genomic
2111
VT17247
9439
CGCAGCGTTGACGAGTGTTAAGCATACGCAGCGTTGACCAGCTGATGATGACTTACGAGCGAATGCCGACGTATGCTGCGCCACCTCTTAATGTTCACCTAATCAGAATCGGGACATTTATCATCATCGTCCTTAAGGAGAATGTATGCACCTTTGGCGAAAATGTGAAATATGATCTCATCATTTTTCATAGGTGTCCTCAATGATTTAAGCTGCACAGCAGTCACTTGTTAACAATTAAAGTCAAGAGCTGTAACCTCTTGTTGGCGACACGAGCGAACAACGCAAGGAAAATTCTTGGGGCAAAAGGCAGGAAAAGCGAGCGATGGCAGCACAATAAATAAAAGATGCAAAGCAACGAACGAACGAAATAAGAAACTATGGTGCAAGGCTGCCTTCGGTCTGCTCCTTCGCTGGCTCCTTCGCTGGCTCCTTCGGCGGCTCCTTGCATTATTATGAGCGATGATGATGTTGCTGCGCCTTACCCCTTCGTAGCCCCCGCTGCATTTCCACCGACGTTGGCTGCATTCTCCCGTTGACAGCGCAAAGTTGAATTGTTTATTTGACTTTTAGTTGTTTTCTTGCCGTTGAAATGCGAGCTGGCTTCTTGGGGGAAAATCGGATGGGGGCAAATTGAAGGAGCCGAGGCAAGTTTCTGCCCTTTGGCTTCAAAGAGTTGTGAGTCCGTGTGAGATGAGGGGTAGCTAGAACTTTCTGTCCTTCATCGCTTGTTGCTGCCGCTGTTTTCTGCTAGTTTCCGAAGCCCCTCCACCGCCCTCGAACCTCAACACATTACCAACTTCCCCTTAGGCAGTCAAACAAGTTAAGTACACAATATGCAAAGCATCCTGCCCCCGTTCTTCCTTCGCTTTGCCATCCATTTTGGCCACAGGACACGGCCGCAGTGCAGAGCAAACTGTTGCTACTCCCGGCAATCAAATGAGGCTCCATCTTCGCCATTTCCCACAGCCGTACAGAGGAAAATATTACCCAAATAATCCATCAATTGCATTGGCTTCTGGCTAAACTTTAAAGAATTCTATTTTTCTCCGTGCACCAACTGTCGATGTTTCGAGGAGGATCAAAATTGTTGCGCAAATCACTCTGAAGCTAGGCTCATATCAGCCAAGGATTCTAAGGATTGCATATATGCCTTTCAATTTCGAGCCTTTGTGGCCGTGCCACCAAATGTTGCCAGAGATGCAAATTAGAAGGGGCAACGACAAAGCCCTATATTGCTTACGAGGGCTTTCCCTTTATATCCGCCAACCCATCACACTGGCTCACACTAATTGATTTGCATATAAGCAAAAATTTTTTTAATTACCCAAAAACCTAAGCGAACTTCTTCGTGGCAGAAAGCATTCAGCCACTACCGTTGTTTACCCAGTCATGTGTGGGGGCGTCAGAGGCGCCACTGCAGGAGGTAAAACGGTGGTTTTGCTGTTCGGGCAACGGTAACAGGGCCTGAATGGCACTTGAAACTTTAGACAGTGGCATATTTCCATTGCATAAATCTGGGCAACAACGCGCAGCGATGGCAAACAGAATGGCGACCACTAAACGCGCGCTAAATGCGGTTTAGCTTTGGAAACTGTATGAAATGTGGTCGCCAGGGGCGCGACGGGGGCGCGCGGATGCGAAACTTGGTTGGACAGGTGCTGCCACGTGTTTAGTTTGCTGCGCAACTGGTCAATGTGGCGGTGGCAGCGGTGAGCGGAGGGGTTCGGGGTCTGTGGATACCGCTGAGGTGGCAGCAGATAGAACGCAACGCTGGTGGGTGGATTGGTCCCCCATCCTGGATGTTATATATCCGGTTTTGTTGGGCCAACTCTTTTCGGTTTTTACCCGGTCACGTCCCGAAAGCGGGTAAAGACACTTTGGGTTTAGGAATGCCACATGATGGGGCACTATATGTGAAATTGGATTGGCACCGAAAATATATATTATTGTATGTCTTATTAGCAATATGGTTGGTATGATCAGAACATGTTTCCATCTACTTAGAAATCATTGAAGCTAAACAAAATTTAAGATCGTTTTTAGATTAAGAAATATTCTAAATTTCCGGAAGGATATGATCTAAGTCCCTGCAATGAAGTTCCTGCAAA
verified
Sign In to show prices
201042
201042
VT-GAL4
248345
CG12510
CG13973
CG13974
CG13975
CG13979
CT33527
CT33528
Doe
Side
Sidestep
doe
downstream of eyeless
side
sidestep
48345
GAL4
GACCATCACAACAGCATTCCACTCAA
ATCCTTCGCCAGGACGACAACAAAA
attP2
genomic
2132
VT48345
-201042
GACCATCACAACAGCATTCCACTCAAAGATGAAAATTTGAAAGGCAAACAAATCTGTCCCATAAGCAAACCCCGGCTGTCTGTGGATCCTGGCTAGCTGGCTGGGATCTGGATGGGATGGGATGCAATGGAATGGCATTGCGAATTGAAGGCGCAGCTTCCGGAGCACGGACTTATGGCTACAAATCAGAAGGACCAACTTACCCCCGGCTGCTCTTTGGCTTTCCCTGGCTAGCTAATCCAAAGGACAGAGGAACTTTCAAGGCCTTCCAACTGGCAAGTTTAATTTATGTTTTTGCTTGGCCAACAGATAGAGAGCAAAACTTTTGCTGCTCGCAGCTATTGTTCCAATGCACTGACCCGTATTTGCAAAGATGTCTGCATAAGCAATTTGTATCTTGTATCTACTATCTTTGTATCTTGCGGATGCTCCGATGCACTTTCACTTTGCCCCGCCAGACGATGGCAATTGTGATAAATTATATGCCACGCGACCGATCGGATTGGATCGTTTCATATCAGATGGGAATCATAATCAAAACCGAAGGGGGCAGGCTGTACGGCCGACGAACTGTTGCGCCCACTCTCACACACACACACACTGATATACTCATATATATACTGACCACTACAAATGAAACCGCAGTGTGTTATTGTGTCATTAATTTGTGCGCTCTCTTTGTGTGGGAATACTCCTTTTTATTGCTGCTTTTTTTGGCGCTTAAAGTGCGAAAACTGACTGGAATTAATTGATGATCCGCACGCAGCTGGAGTGCGGTATTGGTATTGTTGGTTGATTGGGAAATGGAAAATCGAAAATGGGAAATCGTTAATGAGGCAGAGTGACGCGTTCACATTTCCATATGATTTAATGATTTACTTCGGGGGTCCTTCTATCTGCTCTACTACGCACTTTTACGAATTTTCCGCAACTCACTTTTCAGTCTTGCTGTTTGTTTGCCCGCACTTGGAGTTTCATTTTCATTCGCATTTTCCGCTTTCGGCTGTTATTGCTGCTCGTAATCCGCTTTTGCCCTAAATTTCGATTTCCTTTCGCTTTTTTTTTTGCACTGCAGTTATTTCGAACTTCGCTTTTTCCAGTTCTCTTCAAGTGTTTTGATAACTTGAGTGTATTATTATTTTTCCGGCACGTTGTGTTAATTCGTTTCTTCTTTTTTTTTCGTTGTTGTCGTTGTTGTTTCTGGTGGGCGGTAGGGGCGCGGCACACGAAACGTAAACGATGCGCAGCACTTACGGCGCTCGAGAGTCACGCACAAATGGTCCGCCGCCGCCTCCTATTCCTCTAATTAGCCACATAAATTGCAAGTTGGCCAGGGCCAAAAGAATTCAAAACACACTGTCTAGAGAATCGCAATCCCTGCTGAGTAGTGGTGGCAATAGTGGCAAGCGCCAGCAATGGCACAGATATATGTAGCCAAACACGCTATCGATATATAGAGCAGCACCCGCACGACGAACCAAACGCTGTGAGCCACGGATAAGAACTAAACAACATTCGCAGCTGCCGCTGCTCGGCTGCTGCTGCTGCTGCTGCTGCATGTTGTTGCTGCCGCTCGTTGCTGCTCGCTGCTGCTGCTACGGGGTAGCAACACATGCCGCATATCATTCACGATTTTTCACTTCGGACGGCGACGAGCTTCGGATCACGAGTCCTGCCGCGCTCTCTCGTGCCGCATGTTGCTCGTGCGAGTCCTCGTGCAACATGCGGCCAGGACGTGACCTTTGGCAACTGGTCGAGTGTTGTTTTGGCTCTCGGGCGCGCTTGCAGCCAATTAATGGGCCACTCGCCATGTGATTTATTGGCACCGCTCATAAGTCCCCCCCCCTCTTTGCCCAGACAGGATAAACAAAAAACACATGCATAATTTCCATAAATCTTTTATGGCTGCGTGTAAAAACTTTCGGCTGGGCCAATTATGCGGACCGAACTAGGCACTAATTTGACAGCAAAGTGCCCAAAAGGCTTTATCCCTCCTTGGGGGTCAGCCTAGGTCAACTCTGGCCACCCTCCACTCCGCCGTCGTTCGAATCGTGTCCATAACTTACCACATAATTGAGTTATCCCCCGGTTAGGGGCATGAACAAGCTTTTGTTGTCGTCCTGGCGAAGGAT
verified
Sign In to show prices
201089
201089
VT-GAL4
201606
BA34
BcDNA:LD27161
Toc
l(2)01361
l(2)05527
l(2)K08224
l(2)k08224
toc
toucan
1606
GAL4
CAGGCAGCCATTTTAAAGGTTGTATTGCT
TTGAGTTGCTATATATCTCGCATTCTGCC
attP2
genomic
2080
VT1606
-201089
CAGGCAGCCATTTTAAAGGTTGTATTGCTATTTATTGCAAGAAATTCACTTTTGATACACAATAAAATTGAACATATGTCATCAGTCGATTTATAAATTGTACATTCAGTGAACTGAAAAGTAACTTGAATTTATATTCATTTCCCTGCTTATCTCCAAAATAGACAAGTTAACTTAGCTTAAGCACACACAATTCGAAAACGTTTCGTTACGACATTTTTAACCTAAAAGAACCAAAAGAAATCGCCTAGAATATGCTTCCATTTGGTATGTAAGTAGCATTTGGGCATAATTTATTATGCTCCAGGGAACAGCACAGAACAGAACCAGACCGAAGGGAAGGACAATCCGAAGACGACGACATTTATCAAGTGTGCAACTTGAGCAAGGATCCTAGTATCTGCGTACATTCTATACATTTCTCCGCTCTCCTTGACATTGCAAATTTTTTGGAGCAACGCAAATTTAAAATGTAAATCGCTTGCTGCAACACGAGTTGTTATGCCCCACGGCCTTTCTATGGGGCATCCATTCTGAAAGGCTGCCCCCGTTCTCATCTTCATCAGCATTTCTTGCTGCATTCGTGCCTTCATTTTCGTCCCCAATCAATTTTGTAAATTGCATTTGCGATTGATTCCAAAGCATGTTGTTTCCCTCGCCCACCTTCTGCCACTTCTATGCATTCTGAATAAGATGAGAAATATTATCGCACTGTTGCCTCTGCCGCCATTCGGACAAGTGCAACACGGCGTATGCGCAATTTGTTGTGGTCAATGGACGAGGGGGCTGGGAAAAGCCAAGGAAAACCGCTCCGGTTAATGGAATTGCAACCGTGTGAGCTGGAAACCAAGCCCACAACACATCAATCAAGGTCGCAACTCCGTGTAATAGAAATTGCACTTGCTGGCAATATTTCGTTACTATGTGTAAACACACGTCCTTGATTGCCGGTCAATATATTTAATGTTTTCTATAATTGAAGTGTGAAAATGGGTTACAATGGGTTTTTTATAATTATTAAACCCTTTAAAATTAAATCATTTTATTTTACGAAACTTTTTTCTAATACATTTTAGAGATATTCCCTTTGTACTTTTATTATGTTCTCCATTATACCAATACCCATTAAATTGTCAATATTACTTAAGCCCTTTATGGTATTGGAAACTCCCGTTTCACATAATTAAACATGGAATGCAGCAAAAAATTTTCCGTGCAATTGCAAATGGCATTTTACGAGAGAAAATTGTTGACAATAATGAAGCTGATGAACATTTGTGGTTGTGTTCATTGTCATTGTTGCTGCGTTAGTTATTCTACCATCGGTTGGGGTGCATTTGGGCCAGTCTGGAACTGTTTGCGTCATTGTTCAGTTTTAGTTCTCTGCGGTTGCCTGAAATTGTCGTAATGCATTTACGGACATCGCACACACATGTGGCCCAAGTGCGGTTTTGTAGCTGGAAATGTTGGCTGTGTACTGTAAACAAGATTTTAGCAAACCCACTTGCATTTCTCCTGGGGGTCATGTGTCAGCACTTATAATTTTGTTTAAAGAACTAAGAGAAAAATGTCCACTATCTAGAAAATCATTACTATCAAAAAACCCAATTTATATCAGTAACGTTCGATTTCTAAACTCATATTGACATTTTTGTATGTATATTATGTATGTATATAAATGTTCATATTTGTTTCCCTTTTGGTTGCGTACCTAACCACCACCTATAAATTAGCCCGTTCTGCCAATATTAGCCCTTTCATATCTCGTTACTCATACGCCACGTGGTCACGTTTTTGCCTAAGCTCTACGTAGCTGCACTCGCTGCACTTTCCGCTTACGTTTTGTTATTATTTTCCCCAGTACTCGTTAGCCTTGTCTAGTGCCAAAATGAAATGACAATGTTTTCCCAGCGCACAGAACTCAAATCGTAAATCATTTTCTTTTTTTTGGGGTGTTGGCAAAGGTAAACAATGTCACATAGGAGCCCGCAGTTGTCTGTCAGTAGAGAAAAAGGCAAAAAGATTAGAGATATATGGACTGCGGAGAGCGGGGCAGAATGCGAGATATATAGCAACTCAA
verified
Sign In to show prices Temporarily unavailable
201124
201124
VT-GAL4
216127
16127
GAL4
GAGGACATGGCAGGACAGGTGGAA
AAGCGTTGCCCAATCTGTCGGAG
attP2
genomic
2102
VT16127
8211
GAGGACATGGCAGGACAGGTGGAATTTTGCAGCTGGGACTGTAGGTCACGGCAGGACATGTAAAAATTAATTAAGCCCGCCCACCGTCCACGAAACTAATTGAGAATATAAAGCAAATTGCCCGCCCATTCGGCACGAGTCGAAAAATTCAATTTGGATTGGCTCCGCTGAACCAGTTTCTCGATCCCGGACCCTATCGATTGGCTTTGTCTCCTCAAATGTCCGCACAAAACTTTCAATTACAGCCTAGTGTCAAAGATCAACAAACAAACAGCCGATGAGATGCGATGGCTAAGGGACCGGGGGGGTCCTTTGGTGGAAAACCGATGCCTGGGGCAAACATTTCAATTTGCCTGCCTGCCAGCTGACAAAAGCCAAACAACGCCGTGGAAAAAAGAGGCGAAAAATCGAGTGTGGATTGGCCCACAAATCGGACAAATAGCGGAAAAAATAGTGCCAGCTAAACTGAAGAGCTGCATCAGCCTTTTCATATCCTGTGCGAACGGATGTGACAGTGAGCACCAAATGGCAAATGGCGACTAGAATGGAACTCGATGCCCAAAGCCCGGCCCACCGACTTCGGTGGAGGGGATTAGGCCAGTTTCCAGTTGCATCTCACCCAGCAAGACTATCCATGCCTGGAGCGGAATATTAGTTTACAGCGCTTTATTTAGACATGGCCGAAATTCCGGAGCGTTTTTCACGGCAGCAGCTGCTGGCTGGCAAATCGAAATGGCTAAAAAAACCTTATCGAACGACGCTTGCCATATTTGTTTACCCCTGCATTGTGGCATGTGTGAGCTATTATGGCCAAATGAACAAACTGTGGCCCAAAACATGGCCAAAACCCAAAACAATGAATGCCAAAACCCAGGCGCTTGCTGAATAAATCGCATTTTACCCTAGATTTAAGCTTTCAATTGAATACAATGGAATTTATTTATTGCTGTGGCCGATTAAAAATATAATGTCATTACTTAACTTAAAATAATACAAGGAAATGAAACGCATAAGTAATAAACATATTGTAAAATTATTGCTAGATATTTAAGATTTCTTTAAAGAATTTATAAACTTAAATCTTTGCACAGAAATCTCATTTAAACACTCCAAAGTATCCAATAACATTTGTCACACAAGAATATTTCAACTTAAAATAGTTTCAATTAAATACAAAAACCAAGTGACAAGCTGCAGACCGCAAAGGGTATCAACTGATCCATGTGTTGGCCAATAAACATTTAATATTCACATTTTCCAATATTTACTTGTTGGTCATTTTAAAGTGCAACAATATTTGTATAATATAAACAACTTTTTTGCGAGCTACATTTTGATTTACAGCATCAAAATAAACACAAATAAGGGCCCACAAAATATTGGTATTCGTGGATATCGAGATATATTGGTATATGTATGGCAAAGGGCTGATTCAGCATCGATTTATTTTCCTTTCGGTGCAATATGCATGCGTGGCAGCACTTTTTGTGCAAGCAGCCAAATCAGTTTATTGGCGCATAAAATTGAATTAAAACGTGGCTAAAATGGGGGCATGGCGACCACAGGGCGTATGAGCAATCGTGATACCAGCAACTTGGGCTTCCACCATTCAAGCAGCTTTTCTAAGAAAACGCTTATCTATCTTGTTGGCTAAAAACTCATTAAGGTGGTCAAAGGACAAAGGACGAGCCAGAACAAAGCACATTCCAGTCGCATTTTATGTCTTTTTCGTTTAATTAAAATCCACTGACAAGTTTGCATAGATCTATCTTAATACAAATATACATATTTCGTAAACGAATTCACCAGTAAAGCAACAGCAAATAAAAGGGGCCCAGACTGAGCACCATCAGCGGTACCATCATAATACCAAATAGACGCCAGTTCTGGAGGAGATCAAGGGATTAGGATAGGTACTTTCTTGTCATTGGACACATCTTTTAACGTTTAAGTTTAAGTGTAATGCTTTCACATCCGCCACTACTAATTAGTAGTCACTTGATAGTGCTACGAAAAGTTACCCATGGAGCACTTACATCGTGGAACTGCCTGGACACCTGGCCATCCATGTCCAGGCTGCTCCGACAGATTGGGCAACGCTT
verified
Sign In to show prices
201129
201129
VT-GAL4
240556
CG18554
CG31348
CG31350
CG31351
CG33959
CG34055
CG7078
DmCG7078
DmOctbeta3R
OctBeta3
Octbeta3R
Octopamine beta3 receptor
anon-WO0170980.187
anon-WO0170980.188
40556
GAL4
CACAGAAAGGGGAGTTGGTATCGGAG
TGGTGCTGTTACCTGTTTCAAGCAGAA
attP2
genomic
2146
VT40556
35036
CACAGAAAGGGGAGTTGGTATCGGAGAAACACTTTTTCGAATTAAGTTCTTTTTGCTGCTCTGATTGCTTTTTGTGGTTACTTTGTTTTTCCTCGATTTTGCACTTTGTATCTGCTTTTGGCTTGTGCAATTGATATTTTTTTTTATTAAAATTATCATCGATTCGACTGCAATTGGTGTGCGATATGAAATACAAGACTTGTGGTCATCTGCCAAACGAGTTTGTTACACCAAAGTTGCAACAAAGTGCGAACAATTTGCGGTTAATAAAAACCATTATCAGCAATCTCGCACAGAACGTTGGTAATTGAAAATCAAATACGAAGTGTCAGTGCAATGATTTCTTGTTGTCGATACACAGAGTACACGAAGTTTCCGATCGATTGACAATATTCTTTAATTAAATTTTCAATCAAAGCATTCAAATCTCTTACAAATCGCATCATTACGCCAGCTATGAATTTGATTAGCTTATGCCTAAATCCAGACAAACAGACACGCCAATCGGAACAACAATGGTATGCTAAAATGGCTCAAGGCATTCATTCTATTCATCATTTATCCAGGCATTTATCGGGAGACATTCGAGATGCCTTCGTAGGCCAAGGGACCACCCACTGATGAGATATTGCCCGAATAAATGAAGGCATTTACATTTAAAACATTTATGCGCAAATATTTGCCGACCTTAAGGGCCATATTGTCTTACATTCGGCATGGGGTAACGTTCTTTGCACACAAAAACCGAAATAGCAACAGAATCAGATTCAGAATCCGAATCCGAATCTGAATCTGAATCTGAATCAGAGTCCCAGTGAACTCGAAACCATTCGAAAGTTTCCAGCAAATAAAACATGCATACACGAGCATACGCATGTATGACCAAACAATCTGAAACTCGACTGTATTAGTTGAATTCAAACTTTTTCGAGCGTAACTTGAAAAGTTTCAATTTGTGCATGACAATCGCCGTCTGTCAGTAGTCCTTCTCCTCTATCCAACTGTCTATCTGTCGGCGCTCGTACGTGTGGGCCGTATGTCATTTTAGTGTCCCTGCGACACTAAGAAAAAAATAATCCTCCAAGCACTTTAATCTTTACAAAAAATATTATTTGTATAATAAGTCTTAACTAAAAACATGGTATATCGTTCAATAAAACACATTCAGTGTGCTCAGCTATCTCAGTTTTCCATAAATATTATTACTAAAAAAAAGTCATCCTTGTTTATTTCCACTAAAATCCTACACATATCAGTTTCGTTGGAATTTCCAAAACCTACAAATTGCTTGTAATTTCTCCGAATCCACTACAACCAACTCAATGTTATTTCATAAAATGTTTTCGCCATCTGCACAAAGTTTAGAAAGCTGAGTAAAAAACTTTCTTCAATTCAGAGAACGAACTGTGTTACCAAGCAATCGGCAGAGAACTTTGGGGGGCTTTTGATAAATTTGATTTTAAAGGTGGCCCGGTCCGATTTTCAATTAAATGCAAGTGCACTCGTAGGTGCAAAATCGCAAGTGCAGAAAATCGATAGCCAGACTCAGGTGGCGTGCTAGTCGCCTTGGCAAAACCCAGAGGCTTTGCGCTAGCCAGCCAGTTCATTCACGAATGCGAAAAAGGCCAAAAGGCTGGTGGCCAAAGGTGAGACACTAAGGGGTCCAATTCGAATGGGAATGGTTTGGGCGCAGTGCCGTCGGCTGAGCGAATCAAGTGGCAAATGCCAAATGGCATCCTGACCTGACCCAGCGGCCGTAGCAAGAGGAGAAGGCGAAGCAAGAGGAGCAGGAACAGGAGCATCAGCAATAGAAGCCAACTCAGTGGAGGAACTCGACCGTCGGCAAATGGCACACTGTGCACCATGTGCACTGTGATACGGGAATGGAAAACTAACGAGAGGAAATTGTGTTTCAGAAATGCAATGAAAAATTATTGCCGAGCAGTGAAGCGGCACGGATATTTGTCGCTAGTTGCTACAAAAAATCATAGGAAAGCGCATCAAGTCGGGTAAAAAGGAGCTGTGCATGTGCACAATACCTCACTGAATTATAGCAATAAATGTGTTTCGTATAAAATGTGAAAGTAAATGGTGCGAAACGAAGTTTAACTTATGTCTATTCTGCTTGAAACAGGTAACAGCACCA
verified
Sign In to show prices
201194
201194
VT-GAL4
243924
CG14289
CG31149
CG31222
CG5449
CT17110
CT33918
tld-like
43924
GAL4
GACATGGGGGAAGGGATATCACACA
GAACGGGTCCATCCACACCACA
attP2
genomic
2180
38728
GACATGGGGGAAGGGATATCACACATACGCACTGGTGGCGACAAGTTTTGGGCTGTCCACAGGCTGTCGGGCATTTCATGCACAGCCGAGCGGCTGATAGGCAGCCCTCGCAATTTATGGCAGGCAATTTGTATCTGTGGGGTGGTTGGTGATAGCAGATAGGTGGTGGTTATGGCATTTGCCAGTGCCATTCGTAGTGGTTGTGCAAAGGGGGAGGGGGGGGGGGTGCGGATTTATGACAAGTGATGGCCCAGTGGATCGACCGATAATCTCTACTGCGCACAGCCAGGCAATCTCAATCGCAATGGCACATATGCAAATTTGCAAATTCCCACCTCATTTTCTCTCTCAAACAAATACAGATAGAGCACACATCGAATCCAATTCAAAAGTGAGGCACTAGGAAGAAAAAAAAAAAACAGTCCCGCATGAGTAACAGCGCCATGGTGGCCGTGGCCATATGCTGCATCCTCGTCCTGCTGGCCGTCTTCATCGTGATCATCATAGTGGTCGGCCAGACCATCGAGGAGCCCAAATGAGACATGCTCCAGCTGGGACCTGGCAACTTCCCAGATGGATAACAGAGGCCCCCACAAAATTGTTAGTTTGTTGGGGCCGCCAGCAAAAATTTCGTTGCCACCTCATCAGCATCTGCAGCATCCGCAAAATCATCATCAACATCATTTTCACGCGGCTGAAAAATTAGCAGAGGAAACAGAAGGATCAGGAGGAGGAGAAGGAGAACCAGGAGAGGAGAGGAGTGGAGTGGAGTGGAGTGGAGGAAATGCGTCCCATCGTCAGTATCCATTGGCTGTGATGTGAAATTTTTTGAATTTGTGAAGCAAAAATCAATCGAGAAACCAACCAAACACAAAAGGAGCTACTAAATTTTGGAACATTCCGCATCCTAAGAACACACACATCTTCATGTAGCATTTCTGTGTGTTAAGTGTTGTTAATATAAATGTATATATAGATACACAATCTATACAAAATACAAAATACAAAAATATATAGATATCTAGACATACTTACGTAATTATATATGAATATATAGATATATATATATATATATATGTGTGTAACCCAACCGTCGTAAAGTTGCGTTCTTTTTTATAAAAGTGTTGTTAACAAACCGATTTTTATTGATGTTTTAATGATGTTGAATACAACATATACGAGTATATACATGCATACACACACGAAAGTGGAATAAGTTTACATTAAAAGTCCAGCGATGTAAGAATTGATGAGCGGAAACCCAAGAAGCCGTAAAGGATGCAAAGGATTATGGAATCGAAGGAGCAGGACAATAGGGAATGCAACTGGAGAGCTCAATTGTTTATTATACCCTAAGATCATATCAATTCGGAATGATGCCAGCAATTGCACTTGTTAATTGCACAGTAATGAAGGTAAATCCCTTGCGGGATTGTCAGCGGGATAACTGGAGCATAGATATAGCTACCTAAATAAATGGAAGATATGGATTATAGAACAGAGGAGATATGCATTTTATATATCAAAAAACTTTTGGATAAGTTTTACGTGTACGTGTACCTAGGAGTAGCCAAATCTCGTGTATACAATATAAGCTGTTATCAACTATGAAACTTACTCACTTGAAACCAAATGAACTAGGCAACTTTAAACCCCACAAACTGTAATTTAATTGAACCCCAACCAAACAAACAACTACTCCAATTAAATCAATTCAACGCAGAACGTACGTGCGCTGTAATGGATAATAAAGAAAAAAAAAACAACAACTTCCGCTCAATTCGACTCAATTCAGTTTTAATCAATGCAAATGCCAGACTCAGCGAACACAATATTTAACAAATGATCAACGCGCGGCGCATAAATTAATATATTAATTAAATACAAACATCAACAAAAGTGACCAAAGTCAGAGAAGAGTAAAGGTAAGCCGAACATTTTAACGTGTTATACAATGACTTTTCTCTGAATATCCCTACACCAATAGTTTTAATAATGGCCAAACACTTTTTGCGGCTTAAAGTTACTCACATAGAAGGATCAACTGGACAAGGACGAGGGTGGGCTATAAAGTTTCATTGCTGCAGAGGCCCCTGTCAATTTGATTAAAATTGATATGCCCAGTTACTGGGGCAACTGCAGTCCTTGGACTCCTCCATGTGGTGTGGATGGACCCGTTC
suspicious
Sign In to show prices
201231
201231
VT-GAL4
216256
16256
GAL4
CATAGCTGTCCAAAAGTATGCAACGGA
TTGGTAAACCTGACATTGCGCCAGA
attP2
genomic
2187
VT16256
8353
CATAGCTGTCCAAAAGTATGCAACGGAATTTGTATGCGTTTTATAGGTGTTTTAAGTTATGCACAGTAACTTTGTATGTCTGCTGTTTAAAGGATTCTTTGAATTAGAAACACCACTGCTCATATATACCTAAATGTGCATTTTTCAGTACGTTCACAAAATTTTCTTTCAGTGTAAGGCAAGTCTAACAAACACAGAGGAAAAATGAGATAGAATGAAGCAAGGCGTGGGTGGAATGGAAACCGTTTTCGGACGGATTTATTTGCTTAAACCCAAAGTAAAAAGTTCGCTTTGGCTGCGTGGCACGCGGTAACTGTAATTGTCATTATGCCCCCGGGCAGTCAGCCCAGTTACTTACTAACCCCTTGCTGCCACCACCCACCGTCAACCGCCCACCGTTCACAAATCGCGCCATCTCTTTCTGCACCGCTCCAACTGCCAGATGCGGCATCTCTTTCCGTCGCCGTCTGGTTGCCTTTGGAATGTTTGTCTTTGGCTTGGCAGCAAAGTGAAGGCGACTTGAATCATTTTTAACCCCTTCGCAACCCCCTTTGAGCCCAACCAAGTGCTTTTCATATTTAGACGTGCTACTTATTTTATCCCCGCTGCCAACGCTTCTCGTGCATTTTGCCATCATCATCTTGGCCATAATAATCATTTAGAGGAAGTTCGCCTGAGTTACTTGGCACACTCAACAAAGTATCTATCAATATTTGCATTTAGAAGTTCTTTGCCTTCTGGCTTATTTGTTGAGTTATTAACTGGAATTAGGAAAATTGAAATGCGTTTTCCGCATAAGAGCGTGAAATTAAGGTTTCCACCCGCACGCAATGGCAATGCCAATGGCCAACTTGGGTACACTTCGCTACTCTTTTCGGCCAGTCGCCTTAACTTTTCTAATTATGCGACACGATAATTAACTCAATTTGCTCTGATGCGACAACAACAAGTTAAAGAGCGCCAGTGGAAACAAAAGGCCAGGAAAATGTCAGAATATCTCCTACCAATGTGCAATGGCCATGGCCCAAAACAGTTGGCAAGCCGCCGAAAGAAGTGACGGTTTGAGGGGGGAGGAGTGGCCATAAAATGCCATAAAAACCGCCGAGTTGAGCTGAAGTTTCCAAATTGCTGCTCGATGTGGTCGGCTGGAAACGGAGGTCCTTTTTTCCTGTTCAAATTTAGCCGGAAAAGCCAATGCCCATGGACCGAAGTCAATGGTGTATATGTCCTTCGACTGATATGTCCACCAATGTCAATTTTTGATGGCCTTTTTTTTTTGTGATTTTATTAGGTGGAAATGTTTTGCTAAAGCAAGCTACATTTTACTGCGTATATCTTAAAAAAAAAAAAAATTGTATAGAAAAACAAAACCTGTTTCTAACAAGGTGAATCTCTTAAATATACATTTCTGTAACAACTCTTGATGGAAAGACATTAGGTTCATAATCTCAAGAACATTTGCAATACATTTACTTTACTAGATTTTATTGGCTATGCCAAATATAATACGAAACAAGTAATTAATTTATCTTTGATACATTTTTCGCAGGCTTATCCTGCATTGAAGGAGTCTCAGTAATAAACTACCCAACTCATTAGCAATCACACGACCCAGGGTAATCCCCTCAACCGACAGACATATTCGAGGGTTAACCTCAAGTGCCTGTGCCCCCATCGGATTGAAGGGCTCCCAAATGTGCGATTGTCTCCGCCAAACTCCAGAAGCCCGAATTTGCGTGTGGCAAGACCCCGAAATTAGCCCAGTCACGGCGCCAGCTGAAGCTATTAAAAATTGTGAAATAATTTCCAAGCACGCTCCAATGGAGCAATTGGGGATTGTCGCGGAGTGTGGCTGCAATTACTTTGATGATGACTGCGGCGCTGATGATTATGATGATGATGACGCGCACGTTACTCGCGGCATGCAAATAACATGCTAGCACCCGAAATCCTCGACTTTTACAATGGATAGCGAAAGTCAGCAGATCAAGGAACGCACCCCCAGGATTTCCCCAGGATATCCAAGGACTAAGCCTCTATCAGCGGGTGGGCGGGAAATCTCTCGTGTCGAGCCTTTAATCAGGCCGCATTATTATTATCAGCGAGCTATGATATATAGCTATTTGTTTGATGACTTCGGGTGTGTTTTTTCTTTAGGCACATCTGGCGCAATGTCAGGTTTACCAA
verified
Sign In to show prices
201277
201277
VT-GAL4
243284
DmCG16766
TyrRII
Tyramine receptor II
anon-WO0170980.124
anon-WO0170980.125
43284
GAL4
CAATATGTCCGCTTGGCTTTTGTTTTT
TGGGCAAATTGTCACATACATCCACT
attP2
genomic
2110
VT43284
38026
CAATATGTCCGCTTGGCTTTTGTTTTTTTCCAGCATTTCTCTGGCCATTTCCGTTGCGTTTATTGGCCCGGCTTTTATAATTTCCTCTTTTTCACCTTCGTTTTTGTTTTATATTTCGCAGGTATCTCGCCGTCACACAACCACTGACGTACTCCAAGAAGCGCCGATCCAAGCGACTGGCCCTCCTCATGATTCTCGTCGTGTGGATAACTGCCCTGTCAATCACATGTCCACCCTATTTGGGCTGGTAAGTTAGCGCCAGCTGCACGGAGAACAAAATCAACCTTAACCCATGATGGATCGCCTATTCATCTGTTAAGAAAACCATTCATGTTATAATCATTTAATTGAACGCATTAAATTGGGTTGGGAGTACAGGCAACATGTGATAATGATCAGTATCCAAAGGAAGAAAAATAATATATTTAATATCATATAATATTATTAATAATATTATATTATAAATATGGCCAAGATAAATTTATTTGTAGTGCTCTATTAAGTTTATAGATATATATTTTTTTGAATTTTGTAATATTATTTTCACTCTTTCCCGTGTAATTCGAAATATTATATGTAATATTTTTATTGAGCACCCATTTTTTTTTTACCAAATTTGTCCTTCCGGAGGCGTGACAATACTTTGTGGCTTTTTGTGGCTGAAAGTCCTGCTCGCTTTTTTTTTTCTTTTTTGAGCTAATGGCTGTGCGGTGGCGCAGCATAGATAATGTGCTACAAAAGGGTCTCGAAATACACACGTTTATTTATATTATATTTGCGCCTTTGGCTGCGCCTAAAAAACATTACGTAATTGACGACGGGTTGTTGCTGTTGCTGCTGGTCGTGCAGCCATTACATTGAAGTTTTAATGAGTTGTTAATGACTTTGTTTGCCGCGGCGCATTTGCTTTGTTCTCACCTACGCACACACACTCAGCGCGAAAGCCGCACACTTGTGTGTTGCATACTTCCAGGCGCCCAAATTAACCAGCACTCACTCACACACACTCGCACTCACTCACACACACCACAAAGCCAGCATGTCCTTAATGCCATTGGCCATGGCTTAGTTTTGGCCCCCTTTGGCTGAAAGCGAAGAGCATGGCTTAAAGGGCACATTAAAACGGTCTGAGGCCGAATTACAGCCACAGCTGCAGGACATTGGAAAATTTGGAAAATTTGGCGCTGGGGGAAAATCGCAATTATAAGCGCCAGCAGATGGCGCCACTTACATATTTTCATTCTTTAAGCGGACTAGTTTTATGAAAAAAGTTTGCAAATGCAGCGGTTGCAACAACTGTTTGTTTTACTCACAATCTGTTATTTGTTATTGCCTAATGAATACTAAACTGATTGTGTTTGCTTGCTATTTAAATTTAGATTTAACTTTTGGCTAATTGATTTAAGCATTGTTTATTTAGTTCATTTTTTAATTTAACTAATGCATAGCTAATGTATTAAATTGCCCTCAATTTCGGATTGAATAATTAATGTTAAACAAGAAGTTTAGTAGGAAAATCGGCTATTTCCATTCGGGTCTTGTAAATACCAACCTTAACAAAGTTGCATTTGTACAATTATACTGTCAGGTTATTTTGGTATCGGGTAGCAGTAATTACCGTGAGTTTTTGGATAACACATACTTGGGGTAACAAGCAGCTAGTTTAGTTGAATTACAACACCGGAAAATTCCATTGACAGTAGTGACAATGAGGCAATAAACTTTTTGAAAGAGAAACATTATAGGAAACTGTGTATCCAGTGGGCGTGCCCCAAACTTTGGTTGGCATATTTGTAAAAATTGGCCATCCAAAAAATAAATCAAAACAACTGGCAATCATTTTATAATCGTGTGGGCGTGAGTCTTTTAGGCGATTGGGGGGCTTTAGAGTGGGCGTGGTAATGTTCTGAAATAAGCTTGTTCCCGAGATTTGGACTCCGGGGGACAAATGGACATAACCGAATCAAGGATATATATACTTCATGCTTCTGTCTGCTACATGATATTCAGTGAACCTAGTATTCTAAGAATAGTGGGTACAATAACCCAGTATGAACTGGAAGAAGCTGAATCTTGCCACCTACAGTGGATGTATGTGACAATTTGCCCA
verified
Sign In to show prices