201089

Sign In to show prices
SKU
VT-GAL4-201089
More Information
Library VT-GAL4
Construct Id 201606
Status available
VDRC Id 201089
Synonyms BA34
BcDNA:LD27161
Toc
l(2)01361
l(2)05527
l(2)K08224
l(2)k08224
toc
toucan
FlyBase gene number FBgn0010486
FBgn0015600
FBgn0063149
VT ID 1606
Viability viable
Inserted Chromosome 3
Transcriptional Activator GAL4
Insertion Site attP2
Verification Status verified
BrainBase -201089
FlyEnhancers VT1606
Sequence Length 2080
Left Primer CAGGCAGCCATTTTAAAGGTTGTATTGCT
Right Primer TTGAGTTGCTATATATCTCGCATTCTGCC
Template genomic
Sequence CAGGCAGCCATTTTAAAGGTTGTATTGCTATTTATTGCAAGAAATTCACTTTTGATACACAATAAAATTGAACATATGTCATCAGTCGATTTATAAATTGTACATTCAGTGAACTGAAAAGTAACTTGAATTTATATTCATTTCCCTGCTTATCTCCAAAATAGACAAGTTAACTTAGCTTAAGCACACACAATTCGAAAACGTTTCGTTACGACATTTTTAACCTAAAAGAACCAAAAGAAATCGCCTAGAATATGCTTCCATTTGGTATGTAAGTAGCATTTGGGCATAATTTATTATGCTCCAGGGAACAGCACAGAACAGAACCAGACCGAAGGGAAGGACAATCCGAAGACGACGACATTTATCAAGTGTGCAACTTGAGCAAGGATCCTAGTATCTGCGTACATTCTATACATTTCTCCGCTCTCCTTGACATTGCAAATTTTTTGGAGCAACGCAAATTTAAAATGTAAATCGCTTGCTGCAACACGAGTTGTTATGCCCCACGGCCTTTCTATGGGGCATCCATTCTGAAAGGCTGCCCCCGTTCTCATCTTCATCAGCATTTCTTGCTGCATTCGTGCCTTCATTTTCGTCCCCAATCAATTTTGTAAATTGCATTTGCGATTGATTCCAAAGCATGTTGTTTCCCTCGCCCACCTTCTGCCACTTCTATGCATTCTGAATAAGATGAGAAATATTATCGCACTGTTGCCTCTGCCGCCATTCGGACAAGTGCAACACGGCGTATGCGCAATTTGTTGTGGTCAATGGACGAGGGGGCTGGGAAAAGCCAAGGAAAACCGCTCCGGTTAATGGAATTGCAACCGTGTGAGCTGGAAACCAAGCCCACAACACATCAATCAAGGTCGCAACTCCGTGTAATAGAAATTGCACTTGCTGGCAATATTTCGTTACTATGTGTAAACACACGTCCTTGATTGCCGGTCAATATATTTAATGTTTTCTATAATTGAAGTGTGAAAATGGGTTACAATGGGTTTTTTATAATTATTAAACCCTTTAAAATTAAATCATTTTATTTTACGAAACTTTTTTCTAATACATTTTAGAGATATTCCCTTTGTACTTTTATTATGTTCTCCATTATACCAATACCCATTAAATTGTCAATATTACTTAAGCCCTTTATGGTATTGGAAACTCCCGTTTCACATAATTAAACATGGAATGCAGCAAAAAATTTTCCGTGCAATTGCAAATGGCATTTTACGAGAGAAAATTGTTGACAATAATGAAGCTGATGAACATTTGTGGTTGTGTTCATTGTCATTGTTGCTGCGTTAGTTATTCTACCATCGGTTGGGGTGCATTTGGGCCAGTCTGGAACTGTTTGCGTCATTGTTCAGTTTTAGTTCTCTGCGGTTGCCTGAAATTGTCGTAATGCATTTACGGACATCGCACACACATGTGGCCCAAGTGCGGTTTTGTAGCTGGAAATGTTGGCTGTGTACTGTAAACAAGATTTTAGCAAACCCACTTGCATTTCTCCTGGGGGTCATGTGTCAGCACTTATAATTTTGTTTAAAGAACTAAGAGAAAAATGTCCACTATCTAGAAAATCATTACTATCAAAAAACCCAATTTATATCAGTAACGTTCGATTTCTAAACTCATATTGACATTTTTGTATGTATATTATGTATGTATATAAATGTTCATATTTGTTTCCCTTTTGGTTGCGTACCTAACCACCACCTATAAATTAGCCCGTTCTGCCAATATTAGCCCTTTCATATCTCGTTACTCATACGCCACGTGGTCACGTTTTTGCCTAAGCTCTACGTAGCTGCACTCGCTGCACTTTCCGCTTACGTTTTGTTATTATTTTCCCCAGTACTCGTTAGCCTTGTCTAGTGCCAAAATGAAATGACAATGTTTTCCCAGCGCACAGAACTCAAATCGTAAATCATTTTCTTTTTTTTGGGGTGTTGGCAAAGGTAAACAATGTCACATAGGAGCCCGCAGTTGTCTGTCAGTAGAGAAAAAGGCAAAAAGATTAGAGATATATGGACTGCGGAGAGCGGGGCAGAATGCGAGATATATAGCAACTCAA