A. Stark Stocks (AS-STOCK)

AS-STOCK
Shop By
Shopping Options
View as Grid List

Items 1-12 of 32

Set Descending Direction
Name VDRC Id Library Sub-Category Genotype Description Construct Id Chromosome(s) Publication Provider Scientist Provider Organization FlyBase gene number Synonyms Sequence Keywords RRID Comment Name Price (net) Add to Cart
312017
312017
AS-STOCK
w;+;Clktag
312017
-1
Clktag
empty
w;+;Clktag
Sign In to show prices
312018
312018
AS-STOCK
w;If/CyO;Clktag
312018
-1
Clktag
empty
w;If/CyO;Clktag
Sign In to show prices
312041
312041
AS-STOCK
w; ; Cyctag;
312041
-1
Cyctag
empty
w; ; Cyctag;
Sign In to show prices
312042
312042
AS-STOCK
w/Yhh; If/Cyo; cyctag;
312042
-1
TM3Ser
cyctag
w; If/Cyo; cyctag/TM3Ser;
empty
w/Yhh; If/Cyo; cyctag;
Sign In to show prices
312106
312106
AS-STOCK
w; +; Ubx-tag;
312106
-1
empty
w; +; Ubx-tag;
Sign In to show prices
312162
312162
AS-STOCK
enhancer reporter transgene
w[*]; M{brain_synth7-lacZ}ZH-51C
312162
Alexander Stark
Institute of Molecular Pathology (IMP)
brain synth7
hsp70
lacZ
minimal promoter
synthetic enhancer reporter
GTATGTTCCTGCCGACAGGCGAGACATTGTATTTGTATTTCTAGTTCTAACAGAGCAGCGCACCACGCGTTGGTGAGACGGCACTCCACGCTTTACAATTCGGTGCAGCTCCGAGGTATTACATCCCCTGTCCGGGGATGGTGTGGTGGATGGCACCCTGCCTCACACACCTCTCATAATCCAAGCGGGGCCCTAAGGCTTCTACGTAACAATAGGACCGGAGAAGCATTTCGTCGCTTCTCTCATCCAATCGTGCATTAGGGTAACAGTTCTCTGGGAAGGGTGCAAACCACGATTATAGAAATCCCAGGGATGCCGAGGCTACAATTTTTGATGGTGGCGCATGTGTCAGCTACCTGCAAATCTAAAAAGGGATAATGGGACTCATTCCTAGATTCACCAAGCCCACAGGCGCGTCAAATTCGGACCTCGGTCTTACCAGGGTTGTTCAATTCTGCTAGTGAAAGGAAAAACCACACAGGATCGTCCGCGTTCCCCTTT
Synthetic enhancer reporter. Construct 'pBA006 Hsp_brain_synth7-lacZ_attB' (brain_synth7) inserted into the attP landing site line M{3×P3-RFP.attP′}ZH-51C via PhiC31 integrase insertion. Insertion site Chr 2, 51C1, 2R:14732515.
Sign In to show prices
312163
312163
AS-STOCK
enhancer reporter transgene
w[*]; M{brain_synth11-lacZ}ZH-51C
312163
Alexander Stark
Institute of Molecular Pathology (IMP)
brain synth11
hsp70
lacZ
minimal promoter
synthetic enhancer reporter
AATAGAGTGTCCGTGCGGCCTAAGCCATCGGGACGGCTCGGGGCAGGTAGACGGCGAACGAGTACCTCCTATACACATCAGGCTACCTGCTTTACTCTGACACATCAATACAACATGTTCCTTTCCCATGGAAAAGGAGGGGACGGTTTCGCCTCTCTTTGAGTGAGCCATGTGGAGCCTGCCCTCCTATGACGCTTGCGGGGTGCGCTGCAAATCCGGCAATAGTGCGTTGAACGTCGGGCTCATTTCGCCAAAAGTAACGTAGCATAACGGTAATTTCTAATCCTTGGTGTGTACGCCTATAGTGTTCGATGGTAGAGACCTTACCAGGCCCTGTTTAACCTGGATCGCGGAGTGAGCGAGGATTTGAATTTCCTAACAATGTAGGGTAATCTGGAGTAGCTTCGACTTACCGAGATCCATTTGATACGCCTCGTTTCGCCGCGTCATCCGGCAGACGTCTTTTTGTTGGTTTGAACTCACCAAAGCGACTACTGACAT
Synthetic enhancer reporter. Construct 'pBA008 Hsp_brain_synth11-lacZ_attB' (brain_synth11) inserted into the attP landing site line M{3×P3-RFP.attP′}ZH-51C via PhiC31 integrase insertion. Insertion site Chr 2, 51C1, 2R:14732515.
Sign In to show prices
312164
312164
AS-STOCK
enhancer reporter transgene
w[*]; M{CNS_synth1-lacZ}ZH-51C
312164
Alexander Stark
Institute of Molecular Pathology (IMP)
CNS synth1
hsp70
lacZ
minimal promoter
synthetic enhancer reporter
ATTAGTAATCGATTGTGTCGCAGCGCTATTTCGTTTCTATAACAGGTCCTACGAATCATTAGATGAGGAGGGTGCTTTTTGATGGATAGGCGAGCGTCATTTCTTAGAGAACAGCGACGAAATAGGTCTTTCAGTCTAGTACTACGCAGCGGGTCACCTCTAGAACGGAATAATGAACCCGTCCACAGGGGGTGGTTGCGTTGGCCTGGCCTCGGCATAGGTGAACCAGCAGAATAGGTACCTTCCAATCCAACAACGAGTCACAGTGAAGAGTACGGAGGGTTGCTGCGTCCGATTTGTTCTCCAACCCTTGTAGTTAGCCAAGAGTATCTGATCGGAGCAGGGACACCCACCCTGGATTACCCACCCCATCCTTGGCCGTTCGTTCCCCGGCCTGCGCATGAATCGCACGCTCGGTAAGGCAGCGGTGAATGTCCCCTCTAATATTGGCGGTCGTTTGGGTGTGTGATGGCAAGGACTCATTCCTTAGTAAAGGATGAG
Synthetic enhancer reporter. Construct 'pBA010 Hsp_brain-VNC_synth1-lacZ_attB' (CNS_synth1) inserted into the attP landing site line M{3×P3-RFP.attP′}ZH-51C via PhiC31 integrase insertion. Insertion site Chr 2, 51C1, 2R:14732515.
Sign In to show prices
312165
312165
AS-STOCK
enhancer reporter transgene
w[*]; M{CNS_synth2-lacZ}ZH-51C
312165
Alexander Stark
Institute of Molecular Pathology (IMP)
CNS synth2
hsp70
lacZ
minimal promoter
synthetic enhancer reporter
CTATTCTTCAAAAGTGGGTATGCTCTTCATGCCTCTTTAAACGGGTCTTCGTTAGACTACGCCCGTGAGAGAGCTCAGGGTGGGTTTGCCAAGGGTAACGTACAAATACGAACTACCACTCATTTCGAGGGTTGAACGTCCCCTAGCGAGTATAGTTCCTGGTCGTATATAAGGAGCCCAAGATGTAAAAAGGGGATGAAGTCCGGACTTGGTTTCGCAAAAAAGTACCCTGGACCGAAACGGCCCTTATCAATCCTGAGTGGGCTGAGAAATCCCTGTTTTTTATTACTAGCAATGTCAAGGGTTCAGTGCATCAGGAACAGTCGGTCTGTGACCATCAGAATGGGGCCACAGACGAGTTTCAAGGTAGACTAGAATTACCCTCGTTTGTTTTAACGCTTTTAACTAACGTTCAACAGAGGCACCTAGCGCTTAAGGTCCTGCAAGATTGGCTTTACATGTCGAGGATATGAATACTGGCCTATTATTACTACGTCATAG
Synthetic enhancer reporter. Construct 'pBA011 Hsp_brain-VNC_synth2-lacZ_attB' (CNS_synth2) inserted into the attP landing site line M{3×P3-RFP.attP′}ZH-51C via PhiC31 integrase insertion. Insertion site Chr 2, 51C1, 2R:14732515.
Sign In to show prices
312166
312166
AS-STOCK
enhancer reporter transgene
w[*]; M{CNS_synth3-lacZ}ZH-51C
312166
Alexander Stark
Institute of Molecular Pathology (IMP)
CNS synth3
hsp70
lacZ
minimal promoter
synthetic enhancer reporter
TTGGCACCAGCGCGTCAAATTATGACGGATAGCGGGCATGTTACGTGATGCGAAGCCAGTGGTTCTGCAGGGTTGTTTAGATCCGACCCCGTATCCAGAGGGTGGTGGGTTTCACAAGCGAGAGTTTCGAGAAAGGGACTACCCCTGTAGTGATTTTTACTTAAGGGTTGAATGCTCGTAGTCGAAGTACGGGTCACGGGCGGGTGCTACAGTCAACAAGAGCGACGGAAAGAATCCGCAAACAAGCGATACCGATGAGGTAGTAAAATGCAGATCTTACATAAACAAATAGGAGGATGCTCCAAGCCTATGCCACCCTCAGACTTACTCCACTCAGCTATGTTGAGGTTGTGTGTCTAGCGCAGACGCTAAGGACGGCATCTACCCAGGGTAAAGTGAGCTGTCACGTTCGAACATGCAAGATACCATGTGTAAGAGCCTAATGAGATGACCGAGGGTACGCTACTAGCCTACCCTAGGGTAAGAATTCGATTCCCGTAC
Synthetic enhancer reporter. Construct 'pBA012 Hsp_brain-VNC_synth3-lacZ_attB' (CNS_synth3) inserted into the attP landing site line M{3×P3-RFP.attP′}ZH-51C via PhiC31 integrase insertion. Insertion site Chr 2, 51C1, 2R:14732515.
Sign In to show prices
312167
312167
AS-STOCK
enhancer reporter transgene
w[*]; M{CNS_synth4-lacZ}ZH-51C
312167
Alexander Stark
Institute of Molecular Pathology (IMP)
CNS synth4
hsp70
lacZ
minimal promoter
synthetic enhancer reporter
TTGAGTGGCTCTAATGTGCTCGTACGTAGTGCAGAACTCCCATGGAAACGCACGAGACAATGGTTTAAATCCGTAGGGTAACACCGAACGTGGGAATTCGGCTGAGCCAGATATAGAGTTTGTCATGTATTTGCTACGTGTATCTAACGAGGGTGGGTTATCACCCGGGAATTAGAGCCCCGACTGTACTTTGCTACGTAGGGTACGCCGGTTCTGCGAGTTCAACCCCCGATGTGCGTAAATCCTGAAACCGCCAATCCGGGCCGCAAAGGACTAGGGGTAAGCATAGCATCGCCAGGGGTAGGTGGAAGGATCCTCTATAGCGACACTCTTCCTGGATAGCAAGAGGTATATTCGCCATGATGAACCCCCAAATTCATCTAAACAGCTAAGCAGCAACCGGTGTGTGACACAAGGCTCCGACTCTGTCTCAGCGTTGTCACAATGATGAGCGCTAATTGGGTGAGAGAGTTTGCTAACTTCGATGGAGTCAGTTCATTC
Synthetic enhancer reporter. Construct 'pBA013 Hsp_brain-VNC_synth4-lacZ_attB' (CNS_synth4) inserted into the attP landing site line M{3×P3-RFP.attP′}ZH-51C via PhiC31 integrase insertion. Insertion site Chr 2, 51C1, 2R:14732515.
Sign In to show prices
312168
312168
AS-STOCK
enhancer reporter transgene
w[*]; M{CNS_synth5-lacZ}ZH-51C
312168
Alexander Stark
Institute of Molecular Pathology (IMP)
CNS synth5
hsp70
lacZ
minimal promoter
synthetic enhancer reporter
CTGTCAGCAACAAAGCCGGTTGAATAAAACCGCGATCAGAGAGTTGGACTACGAGTTGGTCACAAATAGGTATCCTAGGTCTCAACAGTGGAAGCAGTGGACAACCCTCTCGAATCGTGTGTATGAGACATTCCAGTGAGGTATATCGGCATAACAAACGAGACAAACAACCCCGGTGTCAAGGGTTGGTCAAACTCTCGTCGACCCAGAATTAGGGGTTGGATGTGTATTCCCTATAGGAACACAAGGCGAAGGAGGAATTGCGGACATCTTTCGCAAAACTACGGGATTAATTACGCTTCAATAGTTTTCAATCTGAGCCGTAGCCCAGTTCGCTAGGCATCAAACTAGGGTTAGACGCCCGGTCTCCGATGTAGAGTTCTACCCGGGCTTATCAAGCATCCGTTACTGATTAGTTGGATCTCGATCACCCCTATTCTATGATCGTCTTCCAGCTGGATACTCCTTCTGCGCTTATAGATCCCTGAGGAGCTATGACTA
Synthetic enhancer reporter. Construct 'pBA014 Hsp_brain-VNC_synth5-lacZ_attB' (CNS_synth5) inserted into the attP landing site line M{3×P3-RFP.attP′}ZH-51C via PhiC31 integrase insertion. Insertion site Chr 2, 51C1, 2R:14732515.
Sign In to show prices
Page