GD DNA Plasmids (GD-DNA)

GD-DNA
Shop By
Shopping Options
OFF Targets
  1. 0 8374item
  2. 1 2868item
  3. 2 881item
  4. 3 353item
  5. 4 185item
  6. 5 130item
  7. 6 92item
  8. 7 76item
  9. 8 55item
  10. 9 48item
  11. 10 47item
  12. 11 20item
  13. 12 25item
  14. 13 31item
  15. 14 23item
  16. 15 25item
  17. 16 17item
  18. 17 19item
  19. 18 9item
  20. 19 11item
  21. 20 13item
  22. 21 11item
  23. 22 5item
  24. 23 12item
  25. 24 10item
  26. 25 8item
  27. 26 11item
  28. 27 6item
  29. 28 4item
  30. 29 9item
  31. 30 5item
  32. 31 3item
  33. 32 4item
  34. 33 3item
  35. 34 3item
  36. 35 3item
  37. 36 5item
  38. 37 5item
  39. 38 2item
  40. 39 3item
  41. 40 3item
  42. 41 3item
  43. 42 1 item
  44. 43 4item
  45. 44 3item
  46. 45 1 item
  47. 46 2item
  48. 47 4item
  49. 48 4item
  50. 49 1 item
  51. 51 4item
  52. 52 3item
  53. 53 1 item
  54. 54 1 item
  55. 55 2item
  56. 56 3item
  57. 57 3item
  58. 58 4item
  59. 60 1 item
  60. 61 1 item
  61. 62 2item
  62. 63 2item
  63. 64 3item
  64. 65 2item
  65. 66 1 item
  66. 67 1 item
  67. 68 1 item
  68. 69 3item
  69. 70 5item
  70. 71 4item
  71. 72 1 item
  72. 73 3item
  73. 75 1 item
  74. 76 1 item
  75. 77 1 item
  76. 78 2item
  77. 79 3item
  78. 80 1 item
  79. 81 2item
  80. 84 2item
  81. 85 3item
  82. 86 2item
  83. 87 1 item
  84. 88 1 item
  85. 89 2item
  86. 90 2item
  87. 91 1 item
  88. 92 1 item
  89. 93 1 item
  90. 94 2item
  91. 95 4item
  92. 96 1 item
  93. 99 1 item
  94. 102 5item
  95. 103 1 item
  96. 104 1 item
  97. 105 3item
  98. 106 2item
  99. 109 1 item
  100. 112 1 item
  101. 113 1 item
  102. 114 1 item
  103. 115 1 item
  104. 118 2item
  105. 119 2item
  106. 120 1 item
  107. 121 2item
  108. 122 3item
  109. 126 1 item
  110. 127 2item
  111. 136 2item
  112. 137 3item
  113. 138 1 item
  114. 139 1 item
  115. 142 1 item
  116. 143 2item
  117. 144 1 item
  118. 145 1 item
  119. 146 2item
  120. 150 1 item
  121. 154 1 item
  122. 158 2item
  123. 159 3item
  124. 160 4item
  125. 161 1 item
  126. 162 2item
  127. 163 1 item
  128. 167 2item
  129. 171 1 item
  130. 173 3item
  131. 176 1 item
  132. 177 1 item
  133. 179 2item
  134. 180 3item
  135. 181 1 item
  136. 182 1 item
  137. 190 1 item
  138. 191 1 item
  139. 195 1 item
  140. 196 1 item
  141. 200 1 item
  142. 201 2item
  143. 203 2item
  144. 208 1 item
  145. 209 2item
  146. 210 1 item
  147. 219 1 item
  148. 220 1 item
  149. 223 1 item
  150. 224 1 item
  151. 225 2item
  152. 226 3item
  153. 229 1 item
  154. 230 1 item
  155. 231 1 item
  156. 234 1 item
  157. 235 1 item
  158. 240 1 item
  159. 242 2item
  160. 245 2item
  161. 249 1 item
  162. 250 1 item
  163. 253 1 item
  164. 259 3item
  165. 260 1 item
  166. 261 1 item
  167. 264 1 item
  168. 267 2item
  169. 269 1 item
  170. 271 2item
  171. 274 1 item
  172. 275 1 item
  173. 282 2item
  174. 287 1 item
  175. 288 1 item
  176. 289 2item
  177. 291 2item
  178. 292 1 item
  179. 296 1 item
  180. 302 2item
  181. 306 1 item
  182. 310 2item
  183. 316 1 item
  184. 317 1 item
  185. 318 1 item
  186. 321 1 item
  187. 323 1 item
  188. 325 2item
  189. 327 1 item
  190. 328 1 item
  191. 333 1 item
  192. 334 1 item
  193. 343 1 item
  194. 348 1 item
  195. 351 1 item
  196. 353 1 item
  197. 354 1 item
  198. 358 1 item
  199. 363 1 item
  200. 372 1 item
  201. 375 1 item
  202. 376 2item
  203. 384 1 item
  204. 385 2item
  205. 391 1 item
  206. 395 1 item
  207. 399 1 item
  208. 400 1 item
  209. 403 1 item
  210. 409 1 item
  211. 410 1 item
  212. 413 1 item
  213. 414 1 item
  214. 419 4item
  215. 421 1 item
  216. 429 1 item
  217. 430 1 item
  218. 432 1 item
  219. 433 1 item
  220. 437 1 item
  221. 438 1 item
  222. 445 1 item
  223. 448 1 item
  224. 449 1 item
  225. 450 1 item
  226. 453 1 item
  227. 454 2item
  228. 458 1 item
  229. 460 1 item
  230. 461 1 item
  231. 463 2item
  232. 464 2item
  233. 465 1 item
  234. 466 2item
  235. 467 1 item
  236. 470 1 item
  237. 471 5item
  238. 473 1 item
  239. 474 1 item
  240. 475 2item
  241. 476 1 item
  242. 479 1 item
  243. 480 2item
  244. 481 1 item
  245. 484 2item
  246. 485 1 item
  247. 489 2item
  248. 491 1 item
  249. 492 1 item
  250. 494 3item
  251. 498 1 item
  252. 505 1 item
  253. 506 1 item
  254. 508 1 item
  255. 510 1 item
  256. 512 1 item
  257. 519 1 item
  258. 520 1 item
  259. 521 1 item
  260. 525 2item
  261. 530 1 item
  262. 536 1 item
  263. 538 1 item
  264. 539 1 item
  265. 540 1 item
  266. 545 1 item
  267. 547 1 item
  268. 548 1 item
  269. 551 1 item
  270. 553 1 item
  271. 564 1 item
  272. 565 1 item
  273. 569 1 item
  274. 579 1 item
  275. 582 1 item
  276. 584 1 item
  277. 587 1 item
  278. 591 1 item
  279. 593 1 item
  280. 601 1 item
  281. 602 1 item
  282. 603 1 item
  283. 604 1 item
  284. 610 1 item
  285. 611 1 item
  286. 622 1 item
  287. 623 1 item
  288. 626 1 item
  289. 627 1 item
  290. 631 1 item
  291. 633 2item
  292. 638 2item
  293. 639 1 item
  294. 641 1 item
  295. 656 1 item
  296. 659 1 item
  297. 663 1 item
  298. 669 1 item
  299. 673 1 item
  300. 677 1 item
  301. 680 1 item
  302. 682 1 item
  303. 683 2item
  304. 686 1 item
  305. 690 1 item
  306. 691 1 item
  307. 705 1 item
  308. 713 1 item
  309. 716 2item
  310. 721 1 item
  311. 722 1 item
  312. 725 2item
  313. 728 1 item
  314. 730 1 item
  315. 732 1 item
  316. 737 1 item
  317. 742 1 item
  318. 747 3item
  319. 754 1 item
  320. 764 1 item
  321. 773 1 item
  322. 776 1 item
  323. 780 1 item
  324. 783 1 item
  325. 800 1 item
  326. 805 1 item
  327. 850 1 item
  328. 855 1 item
  329. 878 1 item
View as Grid List

Items 1-12 of 13838

Set Descending Direction
Name VDRC Id Library Sub-Category CG Number (r6.01) Genotype Construct Id FlyBase gene number Synonyms Left Primer Right Primer Hairpin Length Insertion Site Vector Template Sequence RRID Comment Price (net) Add to Cart
dna16467
dna16467
GD-DNA
CG17870
16467
14-3-3
14-3-3 zeta
14-3-3-zeta
14-3-3ZETA
14-3-3leo
14-3-3zeta
2G1
4-3-3 zeta
5.11
549
BEST:GH05075
Complementation group K
D14 3 3 protein
D14-3-3
D14-3-3zeta
K
LEO
LEONARDO
Leo
Leonardo
Leonard
CGCGAATTCCAGGCCATGAAGTCCGTCACA
GCGTCTAGACTCCTGTGGCAACCTCGGCTA
337
cDNA
CAGGCCATGAAGTCCGTCACAGAGACTGGCGTTGAGCTCTCAAATGAGGAAAGAAATCTGCTCTCCGTTGCCTACAAAAATGTGGTCGGTGCCCGCAGGTCATCGTGGCGTGTCATCTCCTCCATTGAGCAGAAAACCGAAGCATCCGCTAGAAAACAGCAGCTCGCCCGTGAGTACAGAGAGCGTGTGGAGAAGGAGCTGAGGGAAATCTGCTACGAAGTTTTGGGACTTCTGGACAAATACCTTATTCCAAAAGCCAGCAATCCCGAGAGCAAGGTGTTTTACCTGAAGATGAAGGGTGATTACTACAGGTATTTAGCCGAGGTTGCCACAGGAG
Sign In to show prices
dna16468
dna16468
GD-DNA
CG10037
16468
Cf1-a
Cf1a
Cf1a/drifter
Cfla
DFR
Dfr
Dfr/Vvl
Drf
Drifter
Drifter/Ventral veinless
PRD gene 3
U-turn
VVL
Ventral Veinless
Ventral veinless
Ventral veins lacking
Vv1
dfr
dfr-vvl
dfr/vvl
drf
drif
CGCGAATTCCAGGGGCGTAAGCGCAAGAA
GCGTCTAGACTCAGCATGGGCGGACTGTG
329
cDNA
CAGGGGCGTAAGCGCAAGAAACGCACCAGCATCGAGGTGAGCGTGAAGGGGGCACTGGAGCAGCACTTCCACAAGCAGCCGAAGCCATCCGCCCAGGAGATAACCTCGTTGGCCGACTCCTTGCAGCTGGAGAAGGAGGTGGTACGCGTGTGGTTCTGCAATCGGCGGCAGAAGGAGAAGCGCATGACGCCGCCAAATACGCTCGGCGGCGACATGATGGACGGCATGCCGCCGGGCCATATGCATCATGGTGGCTATCATCCGCATCACGATATGCACGGCAGTCCGATGGGCACACACTCCCACTCGCACAGTCCGCCCATGCTGAG
Sign In to show prices
dna16471
dna16471
GD-DNA
CG18536
16471
CGCGAATTCCAGTAATTCGGGCGATGAGAGTGA
CGCTCTAGAGTCAGCTTAAAAACGGCTGTGAAACC
308
cDNA
CAGTAATTCGGGCGATGAGAGTGATTACAAGCTGCTACCCTGGGCAATACCCAAACAGCCCTTCTATGATTACATCAACACCTACTATAAGGATGTGATCTCAAAAAACCTCGGCTACTGCTCCAATCTACCCAAATACGAAGATAAATTTCAGCCTCCCTGGCCAAAGAACACCTATAAGCTTGACAAGTGCAAAATCGGTGGTGATGGATTGCCGGAAATCGCTCCGCCAGGATTCTACAAGATCGTATTCACTAAATTTGGTCCTGGGCAGCCAACTTGGGGTTTCACAGCCGTTTTTAAGCTGA
Sign In to show prices
dna16473
dna16473
GD-DNA
CG18104
16473
EG:171D11.4
EG:65F1.3
arg
arginase
CGCGAATTCCAGTCTGCGTCAGGTGCTTCAGAG
GCGTCTAGAAGCGTGCTGCCAGGTGTTACG
397
cDNA
CAGTCTGCGTCAGGTGCTTCAGAGCAGTCATGATGGCCTGGTGATACGGGACTACGGAAATCTGCAGTACGCCGTAGACGAGCCCCTTCTCCAGCAGCAGCGTGTGCACTATCACCACATCCGAAACTACGCGGACTTCATGGCCTGCAATCGGGCACTGATTGAACAGGTGAAACTCATGCTCGTGGAGAACACGCAGTTTTTAGCCATTGGTGGTGATCATGCGATCGGCTTCGGATCCGTGGCCGGGCACCTGCAACACACGCCGAATTTGTCCCTGGTGTGGATCGACGCACATGCGGACATCAATCTGCATAGCACCTCGCAGTCGGGCAACATCCATGGGATGCCTGTATCCTTTCTGTTGGAACAGCTCCGTAACACCTGGCAGCACGCT
Sign In to show prices
dna16474
dna16474
GD-DNA
CG17835
16474
Engrailed/Invected
IV
Inv
Invected
engrailed-invected
engrailed-related
er
in
inv
invected
transcript group IV
CGCGAATTCCAGTGCCCAGCGGTCAGGAT
GCGTCTAGAAGTTGGCGGCGGCGTTACTT
393
cDNA
CAGTGCCCAGCGGTCAGGATGCACTGGCTCAGCTGACGGCCACGGCATTGGGTCTGGGACCCGGTGGAGCGGTGCATCCCCATCAGCAATTGCTACTGCAAAGGGATCAGGTCCACCACCATCATCACATGCAGAATCACCTGAATAACAATGAAAATCTGCACGAAAGGGCGCTCAAATTCAGCATAGACAATATCCTGAAGGCGGACTTTGGTTCCAGATTGCCCAAGATTGGTGCTTTAAGTGGCAATATCGGTGGTGGCAGTGTAAGTGGGAGCAGTACTGGCAGCAGTAAAAATTCTGGAAATACCAATGGCAACAGATCTCCCCTAAAGGCGCCCAAGAAGTCGGGAAAGCCACTGAATCTGGCTCAAAGTAACGCCGCCGCCAACT
Sign In to show prices
dna16475
dna16475
GD-DNA
CG10508
16475
CGCGAATTCCAGTTCGCATCGGAAAAGTTGATTTC
GCGTCTAGAGCTCCCTCTGCTCGTCCTCGT
316
cDNA
CAGTTCGCATCGGAAAAGTTGATTTCTTTGGGCTACACAAAAAGAGATATGCAACAGCCACACAGACCCAACAATCGCCCGCCGGACCTAAATCAAGATCAGGAGGCTGGAGGGGATCAGAGTGGTGTACATATACCGCTGAGACCCAAGGAATACACAGAGGAAGAGAAGACAAAAATGCAAACTTTGCTTAAGGAGAAGTACCCACAGATTGCCGAGCGCATTATCCTAATGGCTTTGGAATCCGTCAACTATGCAGAGGATAGGGCTACGCAAATCCTACAAATAGTCCAGGACGAGGACGAGCAGAGGGAGC
Sign In to show prices
dna16478
dna16478
GD-DNA
CG7007
16478
V-ATPase proton pump
Vacuolar H[+] ATPase PPA1 subunit 1
Vacuolar H[+] ATPase subunit PPA1-1
VhaPPA1
VhaPPA1-1
vhaPPA1-1
CGCGAATTCCATACGACGGGCACGAGCATC
GCGTCTAGATTGACGAACAGGGCGGCATT
326
cDNA
CATACGACGGGCACGAGCATCGTGGGCGGTGGTGTGAAGGCGCCCCGCATCAAGACCAAGAATCTGATCTCGGTCATCTTCTGCGAGGCCGTGGCCATCTACGGCCTGATCACCGCCATCGTTCTGTCCGGCCAGCTGGAGCAGTTCTCGATGGAGACGGCCCTTTCGCAGGCGGCTATTCAGAACACGAACTGGTTCTCCGGCTACCTCATCTTCGGTGCTGGCCTGGCTGTCGGCCTGGTCAATCTGTTCTGCGGCATTGCTGTGGGCATTGTGGGTTCGGGTGCCGCCCTCTCGGACGCCGCCAATGCCGCCCTGTTCGTCAA
Sign In to show prices
dna16480
dna16480
GD-DNA
CG5012
16480
BcDNA:RE53508
L7
L7/12A
L7/L12
Mitochondrial ribosomal protein L5/L17
Mrp17
l(3)10534
l(3)j4B2
l(3)rL424
mRpL12
mRpL7-L12
mitochondrial ribosomal protein L12
mitochondrial ribosomal protein L7/L12
CGCGAATTCCATCACACGCCTCGCCCTTC
GCGTCTAGACGCTGCCTCCTCCTCATCCTC
313
cDNA
CATCACACGCCTCGCCCTTCGCCAGATTTCGCGCCAAGTGCAGCTGCATCGCATGTACAGTGCAGCGGCTCCGGCCGCCGCAGTCTCGGGTGCGGAAAAACTGGTGCCTCCCGCGCCGGAAGGAGCCGCCAAGCCACCCAATCCCAAACTGGACTCGATTGTCAACAACATTGCCGCGCTCAATCTCCTCGAGGTGGCCGAGCTGAGCACCCTGCTCAAACAGAAACTGAACCTGCCCGAGACCGCATTTGCCCCACAATTCGCCGCTGGGCCGGCACGTGCTGCTCCCGCCGAGGATGAGGAGGAGGCAGCG
Sign In to show prices
dna16482
dna16482
GD-DNA
CG43745
16482
CG13802
CG13803
DMS-receptor2
DMSR-2
Dm CG13803
DmsR
DmsR-2
Dromyosuppressin receptor 2
MsR2
Myosuppressin receptor 2
anon-WO0170980.160
anon-WO0170980.161
CGCGAATTCCATCCTCGTCGTTGGGTGAGC
GCGTCTAGAAGTACCGCCAGAAGCATCCTCGT
337
cDNA
CATCCTCGTCGTTGGGTGAGCGCAATGTGACTGTCTATAAGCTGTATCACAGCGCACTGGCGCTGCGTGATCGGCAGTTCAGGAATGCGACCTTCCTTATATACAGTGTCCTGATCAAGCTGATACCCTGCTTCGCACTGACCATTCTGTCTGTGCGGCTCATCGGTGCTCTGTTGGAGGCCAAAAGGAGGAGGAAGATCCTGGCCTGTCATGCAGCCAACGATATGCAGCCAATTGTCAATGGAAAGGTGGTGATTCCGACGCAACCCAAGAGCTGTAAACTGCTGGAGAAGGAGAAGCAGACCGATCGCACCACGAGGATGCTTCTGGCGGTACT
Sign In to show prices
dna16483
dna16483
GD-DNA
CG31792
16483
CG17338
CGCGAATTCCATCCTGGTCACCCATCAGTTGC
GCGTCTAGAGGAATCCGCCTCCTGCCCTA
350
cDNA
CATCCTGGTCACCCATCAGTTGCAGTTCCTGCAGCAGGCCGACCAGATTGTGATCATGGAAATGGGCAAGGTAAAGGCTGTGGGAACGTATGAGTCGCTTCACAAATCGGGTTTAGACTTTGGCATCGTGCTGGATGATCCTGTCAATGACAATGAGGCGGCGGAGGACCGATCAAGAACCTCCAGTATCACGGACCAACGGCGCAGCAGTGTGAAATCTGTACTCTCCCATGCGGAATCCTGTCCAGAGGATGTAGGGGAGGAACAAAAGATTAACCTACAGCGGCAGCAACTGGGTCGCAACGGCTTAGGAGTGTACGTCGATTATTTTAGGGCAGGAGGCGGATTCC
Sign In to show prices
dna16484
dna16484
GD-DNA
CG34385
16484
CG14469
CG7796
CT34165
Dpr-12
Dpr12
dpr12
CGCGAATTCCATCGCATCCCATCGCATCA
GCGTCTAGAGTCGGCAGGCAGAGCAGCAG
370
cDNA
CATCGCATCCCATCGCATCAACTAGCAGCAGCAGCAGCAAGAGCAACCCGGCGAGGCATATGTGCACCGGAGATGCCGGCATTGTGTGGTTGCCGTAGCTGAAAGGATTCAGCGCGTTCATTCAAAAACCCATTAACCCTAATAAGCAGCCACAAAAGGCAGTCAGACAATACGATCCGCCCGCCCATCGATGTGTCAGGACAAAGGGCGCGGACAGTAGGCCGTCATCGGAGGAGAGGAACAACAGAGAAATCACGGGCCTGGCGAGCAAGGGAGCAAGGATGCCAATGGTGCCGCCACGGCTGCTGCTGCGTCTGCGGCGGCCCCTGCACCTGATGGAACTGCGCATCCTGCTGCTCTGCCTGCCGAC
Sign In to show prices
dna16485
dna16485
GD-DNA
CG14966
16485
CGCGAATTCCATCGGTCAACGCCCAAATAATG
GCGTCTAGACGAGATCCCTTGTCCAAAGAAACG
319
cDNA
CATCGGTCAACGCCCAAATAATGTCGAAGAGCAAGGGGAAATCAAAGGCCGGCGTTGAAAGTGCGAAAAACGATGCAAAAGCGATGCCGGCTAAGGAAGCCAGTCCGATTTCAGTCGATAAGAGCGGCAATATATGCATACAAATCCTTGCCAAGCCGGGGGCTAAGCAGAACGGAATCACAGGAATTGGCTTTGAAGGAGTGGGCGTCCAAATCGCCGCTCCGCCCAGCGAGGGAGAAGCTAACGCCGAACTGGTCAAGTTTCTGTCGAAAGTTCTAGGTCTTCGAAAGAGCGACGTTTCTTTGGACAAGGGATCTCG
Sign In to show prices
Page