dna3531

Sign In to show prices
SKU
GD-DNA-DNA3531
More Information
Library GD-DNA
Construct Id 3531
Status available
VDRC Id dna3531
CG Number (r6.01) CG14417
Synonyms EG:BACR43E12.6
FlyBase gene number FBgn0029637
FBgn0040353
Hairpin Length 368
ON Targets 1
OFF Targets 0
CAN Repeats 2
Left Primer CGCGGATCCAGCGGCAGGATGACGGAACA
Right Primer CGCTCTAGAGGCGACCGAGTGACCAGAACC
Template genomic
Sequence AGCGGCAGGATGACGGAACATCGATGTCATATCCGGAATTCCTCCGCTGGAACGAGGCAGCTTTCTATGGCGGAGATTTGGGTTTGAGCGGCTCCAATGGGGCCTATGGTCTGTCGGGCGTCCCTTTGGTACCCATCACCGTTGGCAACGAGGTGAGGTATGTGCCAATGAATCTTCGCATGTTCCGGCAGCTTGTCGGTGATCCCACTACGGTTGCTTCCCCACCACCGCCGTCCATCAGGGAGCAGGATGATCAGCTGGAGGACGACGACATATCCGCCTTGTCCTTGGGCCCCGAACTGGAAGTACTCGACGAGAGCCCCAATGAAGGAGGCCAAGAGGTCGCAGGTTCTGGTCACTCGGTCGCC