dna3519

Sign In to show prices
SKU
GD-DNA-DNA3519

File(s)

There are no file attachments for this product.
More Information
Library GD-DNA
Construct Id 3519
Status available
VDRC Id dna3519
CG Number (r6.01) CG2901
FlyBase gene number FBgn0029679
Hairpin Length 314
ON Targets 1
OFF Targets 0
CAN Repeats 4
Left Primer CGCGAATTCCAGGCCGGAGTCAATCACATTCTT
Right Primer CGCAGATCTCCCATCCAGAAGTCGGCAAATC
Template genomic
Sequence CAGGCCGGAGTCAATCACATTCTTATCTTCGAAATAGACCCCAGAAGTCATCTGCAGCCGGCCACATTTCTAGAAATTGCCTGCACCTTTGGCATTCTTTGGGCCCTGTCCATGTTGGGGTTCCTGTACAACGACTTGATAGGCGTCTCGGATCCCTATGTATTCCCACTGGGACTCATCCTGATCATGGTTGGCCTGCTGGTGGTGCCTCTGCCTATAATGAACTGGCCTGCCAGGTGGTGGACCATTAAGCTGGTGGGTCGCGTCATCACCGCTCCACTGCACTACGTGGGATTTGCCGACTTCTGGATGGG