dna3487

Sign In to show prices
SKU
GD-DNA-DNA3487

File(s)

There are no file attachments for this product.
More Information
Library GD-DNA
Construct Id 3487
Status available
VDRC Id dna3487
CG Number (r6.01) CG8229
Synonyms Uspl1l
FlyBase gene number FBgn0033356
FBgn0064765
Hairpin Length 400
ON Targets 1
OFF Targets 1
CAN Repeats 2
Left Primer CGCGAATTCCACTTCCCATCACTGCTCCACAA
Right Primer CGCTCTAGATGTTCCTTGGCTTTGGTGTCCTC
Template genomic
Sequence CACTTCCCATCACTGCTCCACAATCTGAACTTTTTGAATCTCCTGCTGCTACGCTACCTTCTCACCCTGCGGCCTTAACGTCCAAACCTCCTCCAAATGATGACGAATTTATATTGGAACTGCTGCAGCAATTGACTTCTGCCACAGAAACCCCCCTTAAGACAAATGTGAGTTCCAGTTCCATGCCAAATCTGCACTCGCCTTCAGAGGAAAAACCCTGCCCACAACTGGAGCTTCCCGACTTAAGCTTTCTGGAGGAGAACAGTACCGTATGCAAGGAACCCCCACAAGCATTGAAATCAGAGCTGGGAGTACCTTCAACTGTCGTCTTACCCGACAGATTAATAAGTCCGCCCAAGGCAAAAGCAGTACAAACTGAGGACACCAAAGCCAAGGAACA