dna3482

Sign In to show prices
SKU
GD-DNA-DNA3482
More Information
Library GD-DNA
Construct Id 3482
Status available
VDRC Id dna3482
CG Number (r6.01) CG11198
Synonyms A1Z784_DROME
ACC
Acetyl CoA carboxylase
Acetyl-CoA carboxylase
CG8723
DmACC
acetyl CoA carboxylase
acetyl coA carboxylase
acetyl coenzyme A carboxylase
acetyl-CoA carboxylase
acetyl-coenzyme A carboxylase
dACC
FlyBase gene number FBgn0033245
FBgn0033246
FBgn0043811
Hairpin Length 354
ON Targets 1
OFF Targets 2
s19 0.98
CAN Repeats 2
Left Primer CGCGAATTCGGGAGGATCCAGAGGAGCCAGA
Right Primer CGCTCTAGATGTTAAGCGCAGCATAGCCAGTGA
Template genomic
Sequence GGGAGGATCCAGAGGAGCCAGATAAGGGCTTCAAGTACCTCTACTTGAGCACCGAGGACTACGCCCAGGTGGCCAACCTGAACTCGGTGAGGGCTATCCTGATCGAGGACGAGGGCGAGCAGCGTTACAAGATTACCGACATCATCGGCAAGGACGATGGTCTGGGCGTGGAGAATCTGCGTTACGCCGGCTTGATTGCCGGTGAAACGTCGCAGGCCTACGAGGAGATTGTTACTATCGCTATGGTTACCTGCCGTACCATTGGCATTGGATCCTATGTGGTGCGCCTGGGTCAGCGCGTTATCCAGATCGATAATTCACACATTATACTCACTGGCTATGCTGCGCTTAACA