dna16485

Sign In to show prices
SKU
GD-DNA-DNA16485

File(s)

There are no file attachments for this product.
More Information
Library GD-DNA
Construct Id 16485
Status available
VDRC Id dna16485
CG Number (r6.01) CG14966
FlyBase gene number FBgn0035415
Hairpin Length 319
ON Targets 1
OFF Targets 1
CAN Repeats 0
Left Primer CGCGAATTCCATCGGTCAACGCCCAAATAATG
Right Primer GCGTCTAGACGAGATCCCTTGTCCAAAGAAACG
Template cDNA
Sequence CATCGGTCAACGCCCAAATAATGTCGAAGAGCAAGGGGAAATCAAAGGCCGGCGTTGAAAGTGCGAAAAACGATGCAAAAGCGATGCCGGCTAAGGAAGCCAGTCCGATTTCAGTCGATAAGAGCGGCAATATATGCATACAAATCCTTGCCAAGCCGGGGGCTAAGCAGAACGGAATCACAGGAATTGGCTTTGAAGGAGTGGGCGTCCAAATCGCCGCTCCGCCCAGCGAGGGAGAAGCTAACGCCGAACTGGTCAAGTTTCTGTCGAAAGTTCTAGGTCTTCGAAAGAGCGACGTTTCTTTGGACAAGGGATCTCG