dna16484

Sign In to show prices
SKU
GD-DNA-DNA16484

File(s)

There are no file attachments for this product.
More Information
Library GD-DNA
Construct Id 16484
Status available
VDRC Id dna16484
CG Number (r6.01) CG34385
Synonyms CG14469
CG7796
CT34165
Dpr-12
Dpr12
dpr12
FlyBase gene number FBgn0033044
FBgn0040847
FBgn0085414
Hairpin Length 370
ON Targets 1
OFF Targets 9
s19 0.96
CAN Repeats 5
Left Primer CGCGAATTCCATCGCATCCCATCGCATCA
Right Primer GCGTCTAGAGTCGGCAGGCAGAGCAGCAG
Template cDNA
Sequence CATCGCATCCCATCGCATCAACTAGCAGCAGCAGCAGCAAGAGCAACCCGGCGAGGCATATGTGCACCGGAGATGCCGGCATTGTGTGGTTGCCGTAGCTGAAAGGATTCAGCGCGTTCATTCAAAAACCCATTAACCCTAATAAGCAGCCACAAAAGGCAGTCAGACAATACGATCCGCCCGCCCATCGATGTGTCAGGACAAAGGGCGCGGACAGTAGGCCGTCATCGGAGGAGAGGAACAACAGAGAAATCACGGGCCTGGCGAGCAAGGGAGCAAGGATGCCAATGGTGCCGCCACGGCTGCTGCTGCGTCTGCGGCGGCCCCTGCACCTGATGGAACTGCGCATCCTGCTGCTCTGCCTGCCGAC