dna16483

Sign In to show prices
SKU
GD-DNA-DNA16483

File(s)

There are no file attachments for this product.
More Information
Library GD-DNA
Construct Id 16483
Status available
VDRC Id dna16483
CG Number (r6.01) CG31792
Synonyms CG17338
FlyBase gene number FBgn0032736
FBgn0051792
Hairpin Length 350
ON Targets 1
OFF Targets 0
CAN Repeats 2
Left Primer CGCGAATTCCATCCTGGTCACCCATCAGTTGC
Right Primer GCGTCTAGAGGAATCCGCCTCCTGCCCTA
Template cDNA
Sequence CATCCTGGTCACCCATCAGTTGCAGTTCCTGCAGCAGGCCGACCAGATTGTGATCATGGAAATGGGCAAGGTAAAGGCTGTGGGAACGTATGAGTCGCTTCACAAATCGGGTTTAGACTTTGGCATCGTGCTGGATGATCCTGTCAATGACAATGAGGCGGCGGAGGACCGATCAAGAACCTCCAGTATCACGGACCAACGGCGCAGCAGTGTGAAATCTGTACTCTCCCATGCGGAATCCTGTCCAGAGGATGTAGGGGAGGAACAAAAGATTAACCTACAGCGGCAGCAACTGGGTCGCAACGGCTTAGGAGTGTACGTCGATTATTTTAGGGCAGGAGGCGGATTCC