dna16482

Sign In to show prices
SKU
GD-DNA-DNA16482

File(s)

There are no file attachments for this product.
More Information
Library GD-DNA
Construct Id 16482
Status available
VDRC Id dna16482
CG Number (r6.01) CG43745
Synonyms CG13802
CG13803
DMS-receptor2
DMSR-2
Dm CG13803
DmsR
DmsR-2
Dromyosuppressin receptor 2
MsR2
Myosuppressin receptor 2
anon-WO0170980.160
anon-WO0170980.161
FlyBase gene number FBgn0035329
FBgn0035330
FBgn0046578
Hairpin Length 337
ON Targets 1
OFF Targets 0
CAN Repeats 2
Left Primer CGCGAATTCCATCCTCGTCGTTGGGTGAGC
Right Primer GCGTCTAGAAGTACCGCCAGAAGCATCCTCGT
Template cDNA
Sequence CATCCTCGTCGTTGGGTGAGCGCAATGTGACTGTCTATAAGCTGTATCACAGCGCACTGGCGCTGCGTGATCGGCAGTTCAGGAATGCGACCTTCCTTATATACAGTGTCCTGATCAAGCTGATACCCTGCTTCGCACTGACCATTCTGTCTGTGCGGCTCATCGGTGCTCTGTTGGAGGCCAAAAGGAGGAGGAAGATCCTGGCCTGTCATGCAGCCAACGATATGCAGCCAATTGTCAATGGAAAGGTGGTGATTCCGACGCAACCCAAGAGCTGTAAACTGCTGGAGAAGGAGAAGCAGACCGATCGCACCACGAGGATGCTTCTGGCGGTACT