dna16480

Sign In to show prices
SKU
GD-DNA-DNA16480

File(s)

There are no file attachments for this product.
More Information
Library GD-DNA
Construct Id 16480
Status available
VDRC Id dna16480
CG Number (r6.01) CG5012
Synonyms BcDNA:RE53508
L7
L7/12A
L7/L12
Mitochondrial ribosomal protein L5/L17
Mrp17
l(3)10534
l(3)j4B2
l(3)rL424
mRpL12
mRpL7-L12
mitochondrial ribosomal protein L12
mitochondrial ribosomal protein L7/L12
FlyBase gene number FBgn0011362
FBgn0011514
FBgn0011787
Hairpin Length 313
ON Targets 1
OFF Targets 2
s19 0.99
CAN Repeats 3
Left Primer CGCGAATTCCATCACACGCCTCGCCCTTC
Right Primer GCGTCTAGACGCTGCCTCCTCCTCATCCTC
Template cDNA
Sequence CATCACACGCCTCGCCCTTCGCCAGATTTCGCGCCAAGTGCAGCTGCATCGCATGTACAGTGCAGCGGCTCCGGCCGCCGCAGTCTCGGGTGCGGAAAAACTGGTGCCTCCCGCGCCGGAAGGAGCCGCCAAGCCACCCAATCCCAAACTGGACTCGATTGTCAACAACATTGCCGCGCTCAATCTCCTCGAGGTGGCCGAGCTGAGCACCCTGCTCAAACAGAAACTGAACCTGCCCGAGACCGCATTTGCCCCACAATTCGCCGCTGGGCCGGCACGTGCTGCTCCCGCCGAGGATGAGGAGGAGGCAGCG