dna16478

Sign In to show prices
SKU
GD-DNA-DNA16478

File(s)

There are no file attachments for this product.
More Information
Library GD-DNA
Construct Id 16478
Status available
VDRC Id dna16478
CG Number (r6.01) CG7007
Synonyms V-ATPase proton pump
Vacuolar H[+] ATPase PPA1 subunit 1
Vacuolar H[+] ATPase subunit PPA1-1
VhaPPA1
VhaPPA1-1
vhaPPA1-1
FlyBase gene number FBgn0028662
FBgn0038278
Hairpin Length 326
ON Targets 1
OFF Targets 2
s19 0.98
CAN Repeats 2
Left Primer CGCGAATTCCATACGACGGGCACGAGCATC
Right Primer GCGTCTAGATTGACGAACAGGGCGGCATT
Template cDNA
Sequence CATACGACGGGCACGAGCATCGTGGGCGGTGGTGTGAAGGCGCCCCGCATCAAGACCAAGAATCTGATCTCGGTCATCTTCTGCGAGGCCGTGGCCATCTACGGCCTGATCACCGCCATCGTTCTGTCCGGCCAGCTGGAGCAGTTCTCGATGGAGACGGCCCTTTCGCAGGCGGCTATTCAGAACACGAACTGGTTCTCCGGCTACCTCATCTTCGGTGCTGGCCTGGCTGTCGGCCTGGTCAATCTGTTCTGCGGCATTGCTGTGGGCATTGTGGGTTCGGGTGCCGCCCTCTCGGACGCCGCCAATGCCGCCCTGTTCGTCAA