dna16475

Sign In to show prices
SKU
GD-DNA-DNA16475

File(s)

There are no file attachments for this product.
More Information
Library GD-DNA
Construct Id 16475
Status available
VDRC Id dna16475
CG Number (r6.01) CG10508
FlyBase gene number FBgn0037060
Hairpin Length 316
ON Targets 1
OFF Targets 0
CAN Repeats 2
Left Primer CGCGAATTCCAGTTCGCATCGGAAAAGTTGATTTC
Right Primer GCGTCTAGAGCTCCCTCTGCTCGTCCTCGT
Template cDNA
Sequence CAGTTCGCATCGGAAAAGTTGATTTCTTTGGGCTACACAAAAAGAGATATGCAACAGCCACACAGACCCAACAATCGCCCGCCGGACCTAAATCAAGATCAGGAGGCTGGAGGGGATCAGAGTGGTGTACATATACCGCTGAGACCCAAGGAATACACAGAGGAAGAGAAGACAAAAATGCAAACTTTGCTTAAGGAGAAGTACCCACAGATTGCCGAGCGCATTATCCTAATGGCTTTGGAATCCGTCAACTATGCAGAGGATAGGGCTACGCAAATCCTACAAATAGTCCAGGACGAGGACGAGCAGAGGGAGC