dna16474

Sign In to show prices
SKU
GD-DNA-DNA16474

File(s)

There are no file attachments for this product.
More Information
Library GD-DNA
Construct Id 16474
Status available
VDRC Id dna16474
CG Number (r6.01) CG17835
Synonyms Engrailed/Invected
IV
Inv
Invected
engrailed-invected
engrailed-related
er
in
inv
invected
transcript group IV
FlyBase gene number FBgn0001269
Hairpin Length 393
ON Targets 1
OFF Targets 0
CAN Repeats 5
Left Primer CGCGAATTCCAGTGCCCAGCGGTCAGGAT
Right Primer GCGTCTAGAAGTTGGCGGCGGCGTTACTT
Template cDNA
Sequence CAGTGCCCAGCGGTCAGGATGCACTGGCTCAGCTGACGGCCACGGCATTGGGTCTGGGACCCGGTGGAGCGGTGCATCCCCATCAGCAATTGCTACTGCAAAGGGATCAGGTCCACCACCATCATCACATGCAGAATCACCTGAATAACAATGAAAATCTGCACGAAAGGGCGCTCAAATTCAGCATAGACAATATCCTGAAGGCGGACTTTGGTTCCAGATTGCCCAAGATTGGTGCTTTAAGTGGCAATATCGGTGGTGGCAGTGTAAGTGGGAGCAGTACTGGCAGCAGTAAAAATTCTGGAAATACCAATGGCAACAGATCTCCCCTAAAGGCGCCCAAGAAGTCGGGAAAGCCACTGAATCTGGCTCAAAGTAACGCCGCCGCCAACT