dna16473

Sign In to show prices
SKU
GD-DNA-DNA16473

File(s)

There are no file attachments for this product.
More Information
Library GD-DNA
Construct Id 16473
Status available
VDRC Id dna16473
CG Number (r6.01) CG18104
Synonyms EG:171D11.4
EG:65F1.3
arg
arginase
FlyBase gene number FBgn0023535
FBgn0024982
FBgn0029528
Hairpin Length 397
ON Targets 2
OFF Targets 2
CAN Repeats 3
Left Primer CGCGAATTCCAGTCTGCGTCAGGTGCTTCAGAG
Right Primer GCGTCTAGAAGCGTGCTGCCAGGTGTTACG
Template cDNA
Sequence CAGTCTGCGTCAGGTGCTTCAGAGCAGTCATGATGGCCTGGTGATACGGGACTACGGAAATCTGCAGTACGCCGTAGACGAGCCCCTTCTCCAGCAGCAGCGTGTGCACTATCACCACATCCGAAACTACGCGGACTTCATGGCCTGCAATCGGGCACTGATTGAACAGGTGAAACTCATGCTCGTGGAGAACACGCAGTTTTTAGCCATTGGTGGTGATCATGCGATCGGCTTCGGATCCGTGGCCGGGCACCTGCAACACACGCCGAATTTGTCCCTGGTGTGGATCGACGCACATGCGGACATCAATCTGCATAGCACCTCGCAGTCGGGCAACATCCATGGGATGCCTGTATCCTTTCTGTTGGAACAGCTCCGTAACACCTGGCAGCACGCT