dna16471

Sign In to show prices
SKU
GD-DNA-DNA16471

File(s)

There are no file attachments for this product.
More Information
Library GD-DNA
Construct Id 16471
Status available
VDRC Id dna16471
CG Number (r6.01) CG18536
FlyBase gene number FBgn0034322
Hairpin Length 308
ON Targets 1
OFF Targets 0
CAN Repeats 3
Left Primer CGCGAATTCCAGTAATTCGGGCGATGAGAGTGA
Right Primer CGCTCTAGAGTCAGCTTAAAAACGGCTGTGAAACC
Template cDNA
Sequence CAGTAATTCGGGCGATGAGAGTGATTACAAGCTGCTACCCTGGGCAATACCCAAACAGCCCTTCTATGATTACATCAACACCTACTATAAGGATGTGATCTCAAAAAACCTCGGCTACTGCTCCAATCTACCCAAATACGAAGATAAATTTCAGCCTCCCTGGCCAAAGAACACCTATAAGCTTGACAAGTGCAAAATCGGTGGTGATGGATTGCCGGAAATCGCTCCGCCAGGATTCTACAAGATCGTATTCACTAAATTTGGTCCTGGGCAGCCAACTTGGGGTTTCACAGCCGTTTTTAAGCTGA