dna16468

Sign In to show prices
SKU
GD-DNA-DNA16468

File(s)

There are no file attachments for this product.
More Information
Library GD-DNA
Construct Id 16468
Status available
VDRC Id dna16468
CG Number (r6.01) CG10037
Synonyms Cf1-a
Cf1a
Cf1a/drifter
Cfla
DFR
Dfr
Dfr/Vvl
Drf
Drifter
Drifter/Ventral veinless
PRD gene 3
U-turn
VVL
Ventral Veinless
Ventral veinless
Ventral veins lacking
Vv1
dfr
dfr-vvl
dfr/vvl
drf
drif
FlyBase gene number FBgn0000285
FBgn0003146
FBgn0003995
Hairpin Length 329
ON Targets 1
OFF Targets 1
s19 0.99
CAN Repeats 3
Left Primer CGCGAATTCCAGGGGCGTAAGCGCAAGAA
Right Primer GCGTCTAGACTCAGCATGGGCGGACTGTG
Template cDNA
Sequence CAGGGGCGTAAGCGCAAGAAACGCACCAGCATCGAGGTGAGCGTGAAGGGGGCACTGGAGCAGCACTTCCACAAGCAGCCGAAGCCATCCGCCCAGGAGATAACCTCGTTGGCCGACTCCTTGCAGCTGGAGAAGGAGGTGGTACGCGTGTGGTTCTGCAATCGGCGGCAGAAGGAGAAGCGCATGACGCCGCCAAATACGCTCGGCGGCGACATGATGGACGGCATGCCGCCGGGCCATATGCATCATGGTGGCTATCATCCGCATCACGATATGCACGGCAGTCCGATGGGCACACACTCCCACTCGCACAGTCCGCCCATGCTGAG