dna16467

Sign In to show prices
SKU
GD-DNA-DNA16467

File(s)

There are no file attachments for this product.
More Information
Library GD-DNA
Construct Id 16467
Status available
VDRC Id dna16467
CG Number (r6.01) CG17870
Synonyms 14-3-3
14-3-3 zeta
14-3-3-zeta
14-3-3ZETA
14-3-3leo
14-3-3zeta
2G1
4-3-3 zeta
5.11
549
BEST:GH05075
Complementation group K
D14 3 3 protein
D14-3-3
D14-3-3zeta
K
LEO
LEONARDO
Leo
Leonardo
Leonard
FlyBase gene number FBgn0004907
FBgn0010635
FBgn0019723
Hairpin Length 337
ON Targets 1
OFF Targets 0
CAN Repeats 2
Left Primer CGCGAATTCCAGGCCATGAAGTCCGTCACA
Right Primer GCGTCTAGACTCCTGTGGCAACCTCGGCTA
Template cDNA
Sequence CAGGCCATGAAGTCCGTCACAGAGACTGGCGTTGAGCTCTCAAATGAGGAAAGAAATCTGCTCTCCGTTGCCTACAAAAATGTGGTCGGTGCCCGCAGGTCATCGTGGCGTGTCATCTCCTCCATTGAGCAGAAAACCGAAGCATCCGCTAGAAAACAGCAGCTCGCCCGTGAGTACAGAGAGCGTGTGGAGAAGGAGCTGAGGGAAATCTGCTACGAAGTTTTGGGACTTCTGGACAAATACCTTATTCCAAAAGCCAGCAATCCCGAGAGCAAGGTGTTTTACCTGAAGATGAAGGGTGATTACTACAGGTATTTAGCCGAGGTTGCCACAGGAG