7094

Sign In to show prices
SKU
GD-7094
More Information
Library GD
Construct Id 3247
Status temporarily unavailable
VDRC Id 7094
CG Number (r6.01) CG6048
Synonyms SP108
FlyBase gene number FBgn0029827
Viability sterile
Hairpin Length 350
ON Targets 1
OFF Targets 0
CAN Repeats 4
Inserted Chromosome 2
Left Primer CGCGAATTCCGCACCAACACGCTAACATTCAC
Right Primer CGCTCTAGAGCATCCTTTTCTCCCACCTCCA
Template genomic
Sequence CGCACCAACACGCTAACATTCACGATCGAAGAGCGCATAATGCAGCTGGATAAGTTCGACCTTTCCACCTACGACAAGGACATCGCCCTGCTGATGCTGAATGGTACTGTACCCACTGGACATCCGACCATTCGTCCAATTGCCCTCAATCGGTTTGCCATACCGGAGGGCGTCGTCTGCCAGGTGACGGGCTGGGGCAATACGGAGGATGGCTATGTCTCCGACATCCTGATGACCGTCGATGTGCCGATGATCAGCGAGGAGCATTGCATCAATGACAGCGACCTGGGCCACCTGATTCAGCCGGGAATGATATGTGCCGGTTATTTGGAGGTGGGAGAAAAGGATGC