7041

Sign In to show prices
SKU
GD-7041
More Information
Library GD
Construct Id 3227
Status available
VDRC Id 7041
CG Number (r6.01) CG6978
FlyBase gene number FBgn0029727
Viability viable
Hairpin Length 311
ON Targets 1
OFF Targets 0
CAN Repeats 3
Inserted Chromosome 2
Left Primer CGCGAATTCGCCCTGCTCCCACTCTTTGCT
Right Primer CGCTCTAGAGGCTCCTTTCCTCCGGCTGT
Template genomic
Sequence GCCCTGCTCCCACTCTTTGCTGGCCCAGTGGGTTCCCCCGAACGAGAGATCACTGGCCGGAGCAGCGGTCTACGCAGGTGCCCAGTTTGGTACCATAGTATCTATGCCATTGAGTGGACTTCTGGCTCACTACGGTTTCGATGGCGGCTGGCCATCGATCTTCTATATCTTCGGGCTGTTCAGCACCATCTGGTGTATCATCTTTATTTGCCTGGTGCAGGAGAGTCCGGCCGTGAGTACTCGCATCTCGGAGGCGGAGAGGCGACACATCATGGAGGCCATTTGGCAGGCACAGCCGGAGGAAAGGAGCC