343740
Sign In to show prices
SKU
HD-CFD-12A-343740
| VDRC Id | 343740 |
|---|---|
| Library | HD-CFD-12a |
| Sub-Category | sgRNA |
| Status | available |
| Comment | Expression of multiplexed sgRNAs from a U6:3 promoter targeting gene FBgn0261618. |
| Construct Id | 343740 |
| Genotype | P{ry[+t7.2]=hsFLP}12, y[1] w[*]; P{y[+t7.7] w[+mC]=HD12aCFD0741}attP40/CyO, P{GFP, w[-]} |
| Gene Symbol | larp |
| Gene Name | La related protein |
| FlyBase gene number | FBgn0039578 FBgn0039579 FBgn0040108 FBgn0047231 FBgn0061057 FBgn0061128 FBgn0260724 FBgn0261618 |
| Synonyms | 0031/08 0225/29 BcDNA:LD02611 CG14065 CG14066 CRISPR Cas12a Drosophila La related protein HD12aCFD0741 La related protein La-related protein Larp dlarp knockout l(3)S003108 l(3)S022529 larp larp1 letha |
| Keywords | knockout CRISPR sgRNA Cas12a |
| CG Number (r6.01) | CG42551 |
| Sequence | sgRNA_1GCAACGTGCCCGCCGCCTACATCsgRNA_2CTGACCATCATTCTGCTCCAACTsgRNA_3TGGCCATCGCCGATGTGAGAATGsgRNA_4AGTGGACTGGCTGAGAGTGTGAA |
| Vector | 343740 |
| Inserted Chromosome | 2 |
| Viability | viable |
| Publication | Port et al., biorxiv (2024) |
| Provider Scientist | Fillip Port and Michael Boutros |
| Provider Organization | DKFZ, Heidelberg |