343095
Sign In to show prices
SKU
HD-CFD-12A-343095
| VDRC Id | 343095 |
|---|---|
| Library | HD-CFD-12a |
| Sub-Category | sgRNA |
| Status | available |
| Comment | Expression of multiplexed sgRNAs from a U6:3 promoter targeting gene FBgn0033791. |
| Construct Id | 343095 |
| Genotype | P{ry[+t7.2]=hsFLP}12, y[1] w[*]; P{y[+t7.7] w[+mC]=HD12aCFD0096}attP40/CyO, P{GFP, w[-]} |
| Gene Symbol | Drl-2 |
| Gene Name | Derailed 2 |
| FlyBase gene number | FBgn0033790 FBgn0033791 |
| Synonyms | CG12463 CRISPR Cas12a DNT-like DRL-2 Derailed 2 Derailed-2 Drl-2 HD12aCFD0096 derailed-2 dnl doughnut-like drl-2 knockout sgRNA |
| Keywords | CRISPR knockout Cas12a sgRNA |
| CG Number (r6.01) | CG3915 |
| Sequence | sgRNA_1CACTTCGGTCAGCGGCTATCTGAsgRNA_2CGCGCCCTCACATACATCATGCTsgRNA_3ACCACCGCAGCTTATGGCAGCCAsgRNA_4TTGAGGCTGGCAATGGTCGCATA |
| Vector | 343095 |
| Inserted Chromosome | 2 |
| Viability | viable |
| Publication | Port et al., biorxiv (2024) |
| Provider Scientist | Fillip Port and Michael Boutros |
| Provider Organization | DKFZ, Heidelberg |