343094
Sign In to show prices
SKU
HD-CFD-12A-343094
| VDRC Id | 343094 |
|---|---|
| Library | HD-CFD-12a |
| Sub-Category | sgRNA |
| Status | available |
| Comment | Expression of multiplexed sgRNAs from a U6:3 promoter targeting gene FBgn0263998. |
| Construct Id | 343094 |
| Genotype | P{ry[+t7.2]=hsFLP}12, y[1] w[*]; P{y[+t7.7] w[+mC]=HD12aCFD0095}attP40/CyO, P{GFP, w[-]} |
| Gene Symbol | Ack-like |
| Gene Name | Activated Cdc42 kinase-like |
| FlyBase gene number | FBgn0013955 FBgn0019939 FBgn0022801 FBgn0053007 FBgn0263998 |
| Synonyms | Ack-like Activated Cdc42 kinase-like CG33007 CG3969 CRISPR Cas12a DPR2 DRODPR2 DmHD-11 Fak-like tyrosine kinase HD-11 HD12aCFD0095 PR2 PR2/ACK Rp2 dACK knockout sgRNA tyrosine kinase |
| Keywords | Cas12a CRISPR sgRNA knockout |
| CG Number (r6.01) | CG43741 |
| Sequence | sgRNA_1CCACAGGCAAACTCCAAAGGCCCsgRNA_2AGCCCTGGGCGGCACTTACCGGCsgRNA_3GCTTGCACAACTATGGTGCGGATsgRNA_4CCATCCGCACCATAGTTGTGCAA |
| Vector | 343094 |
| Inserted Chromosome | 2 |
| Viability | viable |
| Publication | Port et al., biorxiv (2024) |
| Provider Scientist | Fillip Port and Michael Boutros |
| Provider Organization | DKFZ, Heidelberg |