343092
Sign In to show prices
SKU
HD-CFD-12A-343092
| VDRC Id | 343092 |
|---|---|
| Library | HD-CFD-12a |
| Sub-Category | sgRNA |
| Status | available |
| Comment | Expression of multiplexed sgRNAs from a U6:3 promoter targeting gene FBgn0002723. |
| Construct Id | 343092 |
| Genotype | P{ry[+t7.2]=hsFLP}12, y[1] w[*]; P{y[+t7.7] w[+mC]=HD12aCFD0093}attP40/CyO, P{GFP, w[-]} |
| Gene Symbol | Met |
| Gene Name | Methoprene-tolerant |
| FlyBase gene number | FBgn0002723 |
| Synonyms | CRISPR Cas12a DmMet HD12aCFD0093 MET Met Methoprene-tolerant Methoprene-tolerant protein Mett Resistance (1) Juvenile H Resistance to Juvenile Hormone Rst(1)JH bHLHe59 juvenile hormone resistance knockout met |
| Keywords | CRISPR knockout Cas12a sgRNA |
| CG Number (r6.01) | CG1705 |
| Sequence | sgRNA_1TCCAGGCGACGGGAGGATTCGGCsgRNA_2TTGCGACGTCTGGAAGCGGACTTsgRNA_3CCGTCCGCTTGGCTAGGGCTTCCsgRNA_4ATCACAGTCGATGATGCTGCCGT |
| Vector | 343092 |
| Inserted Chromosome | 2 |
| Viability | viable |
| Publication | Port et al., biorxiv (2024) |
| Provider Scientist | Fillip Port and Michael Boutros |
| Provider Organization | DKFZ, Heidelberg |