343091
Sign In to show prices
SKU
HD-CFD-12A-343091
| VDRC Id | 343091 |
|---|---|
| Library | HD-CFD-12a |
| Sub-Category | sgRNA |
| Status | available |
| Comment | Expression of multiplexed sgRNAs from a U6:3 promoter targeting gene FBgn0010453. |
| Construct Id | 343091 |
| Genotype | P{ry[+t7.2]=hsFLP}12, y[1] w[*]; P{y[+t7.7] w[+mC]=HD12aCFD0092}attP40/CyO, P{GFP, w[-]} |
| Gene Symbol | Wnt4 |
| Gene Name | Wnt oncogene analog 4 |
| FlyBase gene number | FBgn0010453 |
| Synonyms | CRISPR Cas12a DWnt-4 DWnt4 Dm DWnt4 Dwnt4 HD12aCFD0092 Wnt Wnt oncogene analog 4 Wnt-4 Wnt4 anon-EST:Liang-2.4 clone 2.4 knockout sgRNA wnt-4 wnt4 |
| Keywords | Cas12a CRISPR sgRNA knockout |
| CG Number (r6.01) | CG4698 |
| Sequence | sgRNA_1TGCTAATGATCCTCACCCACCTGsgRNA_2GTTTGGGCCAGGTGCGAAACGAGsgRNA_3GCCAGTCCAGCCAGAGCGTGTCCsgRNA_4CGCGCGTCTCGATCGAGCAGTTC |
| Vector | 343091 |
| Inserted Chromosome | 2 |
| Viability | viable |
| Publication | Port et al., biorxiv (2024) |
| Provider Scientist | Fillip Port and Michael Boutros |
| Provider Organization | DKFZ, Heidelberg |