343082
Sign In to show prices
SKU
HD-CFD-12A-343082
| VDRC Id | 343082 |
|---|---|
| Library | HD-CFD-12a |
| Sub-Category | sgRNA |
| Status | available |
| Comment | Expression of multiplexed sgRNAs from a U6:3 promoter targeting gene FBgn0037555. |
| Construct Id | 343082 |
| Genotype | P{ry[+t7.2]=hsFLP}12, y[1] w[*]; P{y[+t7.7] w[+mC]=HD12aCFD0083}attP40/CyO, P{GFP, w[-]} |
| Gene Symbol | Ada2b |
| Gene Name | transcriptional Adaptor 2b |
| FlyBase gene number | FBgn0037555 |
| Synonyms | ADA2b Ada2B Ada2S Ada2b BcDNA:LD24527 CRISPR Cas12a HD12aCFD0083 Transcriptional adapter 2S ada2b dADA2b dAda2B dAda2S dAda2b knockout sgRNA transcriptional Adaptor 2b |
| Keywords | Cas12a CRISPR knockout sgRNA |
| CG Number (r6.01) | CG9638 |
| Sequence | sgRNA_1CCGCAGGTGCGGAGATCGGCGCCsgRNA_2CACGAAATACACTCAATATGGAAsgRNA_3CAAACTTATTCACGTACTCCTCTsgRNA_4CAGTGGAGGCAAGGTAGAGAGAG |
| Vector | 343082 |
| Inserted Chromosome | 2 |
| Viability | viable |
| Publication | Port et al., biorxiv (2024) |
| Provider Scientist | Fillip Port and Michael Boutros |
| Provider Organization | DKFZ, Heidelberg |