341040

Sign In to show prices
SKU
HD-CFD-341040

File(s)

There are no file attachments for this product.
More Information
Library HD-CFD
Construct Id 341040
Status available
VDRC Id 341040
Sub-Category sgRNA
HD_CFD ID HD_CFD00043
FlyBase gene number FBgn0039809
Viability unknown
Vector pCFD6
Insertion Site attP40
Inserted Chromosome 2
Target sgRNA1 GGTGCGTGTTTCCGATTACC
Target sgRNA2 TCCGGTGCTCTTAAAGTTGC