330126

Sign In to show prices
SKU
SHRNA-330126

File(s)

There are no file attachments for this product.
More Information
Library shRNA
Construct Id 330126
Status available
VDRC Id 330126
CG Number (r6.01) CG5508
Sub-Category shRNA Stocks
Synonyms 152088_at
BcDNA:GH07066
GPAT1
mino
minotaur
FlyBase gene number FBgn0027579
Insertion Site attP40
Viability viable
Inserted Chromosome 2
21bp Sequence (sense) AAGAAGATCGACGCAATTGTA
21bp Sequence (antisense) TACAATTGCGTCGATCTTCTT
Sequence ctagcagtAAGAAGATCGACGCAATTGTAtagttatattcaagcataTACAATTGCGTCGATCTTCTTgcg