330124

Sign In to show prices
SKU
SHRNA-330124
More Information
Library shRNA
Construct Id 330124
Status available
VDRC Id 330124
CG Number (r6.01) CG5423
Sub-Category shRNA Stocks
Synonyms CG14345
CT17158
ROBO3
Robo 3
Robo-3
Robo3
Roundabout 3
dRobo-3
robo3
FlyBase gene number FBgn0031328
FBgn0031330
FBgn0041097
Insertion Site attP40
Viability viable
Inserted Chromosome 2
21bp Sequence (sense) CGACGCGGATATTCAAAAATA
21bp Sequence (antisense) TATTTTTGAATATCCGCGTCG
Sequence ctagcagtCGACGCGGATATTCAAAAATAtagttatattcaagcataTATTTTTGAATATCCGCGTCGgcg