330123

Sign In to show prices
SKU
SHRNA-330123
More Information
Library shRNA
Construct Id 330123
Status available
VDRC Id 330123
CG Number (r6.01) CG5373
Sub-Category shRNA Stocks
Synonyms DmVps34
PI 3-kinase
PI(3)K
PI3-kinase
PI3K
PI3K-59F
PI3K_59F
PI[[3]]K
Phosphotidylinositol 3 kinase 59F
Pi3K59F
Pi3K_59F
VPS34
Vps34
dPI 3-kinase
dPI3K
dVps34
dVps34/PI3K59F
vps34
FlyBase gene number FBgn0015277
Insertion Site attP40
Viability viable
Inserted Chromosome 2
21bp Sequence (sense) AGCTGCTGAGTCCGACTTTTA
21bp Sequence (antisense) TAAAAGTCGGACTCAGCAGCT
Sequence ctagcagtAGCTGCTGAGTCCGACTTTTAtagttatattcaagcataTAAAAGTCGGACTCAGCAGCTgcg