330122

Sign In to show prices
SKU
SHRNA-330122
More Information
Library shRNA
Construct Id 330122
Status available
VDRC Id 330122
CG Number (r6.01) CG5193
Sub-Category shRNA Stocks
Synonyms TFIIB
TfIIB
Tfiib
TfllB
Transcription factor IIB
dTFIIB
dTfIIB
dmTFIIB
FlyBase gene number FBgn0004915
FBgn0023206
Insertion Site attP40
Viability viable
Inserted Chromosome 2
21bp Sequence (sense) AGACAAGTGTGGATCTCATAA
21bp Sequence (antisense) TTATGAGATCCACACTTGTCT
Sequence ctagcagtAGACAAGTGTGGATCTCATAAtagttatattcaagcataTTATGAGATCCACACTTGTCTgcg