330121

Sign In to show prices
SKU
SHRNA-330121
More Information
Library shRNA
Construct Id 330121
Status available
VDRC Id 330121
CG Number (r6.01) CG4978
Sub-Category shRNA Stocks
Synonyms DmMCM7
DmeMCM7
MCM7
McM7
Mcm7
Mcp-PCR1
Minichromosome maintenance 7
Minichromosome maintenance-PCR1
PCR1
anon-EST:Liang-1.66
clone 1.66
dMcm7
mcm7
minichromosome maintenance 7
FlyBase gene number FBgn0020633
FBgn0025980
Insertion Site attP40
Viability viable
Inserted Chromosome 2
21bp Sequence (sense) TCGACAATTGTCGGCGATACA
21bp Sequence (antisense) TGTATCGCCGACAATTGTCGA
Sequence ctagcagtTCGACAATTGTCGGCGATACAtagttatattcaagcataTGTATCGCCGACAATTGTCGAgcg