330120

Sign In to show prices
SKU
SHRNA-330120
More Information
Library shRNA
Construct Id 330120
Status available
VDRC Id 330120
CG Number (r6.01) CG4971
Sub-Category shRNA Stocks
Synonyms D-Wnt-10
DWnt-10
DWnt10
Dm DWnt10
Wnt oncogene analog 10
Wnt10
wnt10
FlyBase gene number FBgn0031903
Insertion Site attP40
Viability viable
Inserted Chromosome 2
21bp Sequence (sense) TGGAGACCAATCAGATTCTAA
21bp Sequence (antisense) TTAGAATCTGATTGGTCTCCA
Sequence ctagcagtTGGAGACCAATCAGATTCTAAtagttatattcaagcataTTAGAATCTGATTGGTCTCCAgcg