330119

Sign In to show prices
SKU
SHRNA-330119

File(s)

There are no file attachments for this product.
More Information
Library shRNA
Construct Id 330119
Status available
VDRC Id 330119
CG Number (r6.01) CG4944
Sub-Category shRNA Stocks
Synonyms Ciboulot
Ciboulout
EG0007-11
EG:EG0007.11
beta-thymosin
cib
ciboulet
ciboulot
FlyBase gene number FBgn0026084
Insertion Site attP40
Viability viable
Inserted Chromosome 2
21bp Sequence (sense) AGGACAAACTGAAGAACGCTA
21bp Sequence (antisense) TAGCGTTCTTCAGTTTGTCCT
Sequence ctagcagtAGGACAAACTGAAGAACGCTAtagttatattcaagcataTAGCGTTCTTCAGTTTGTCCTgcg