330118

Sign In to show prices
SKU
SHRNA-330118
More Information
Library shRNA
Construct Id 330118
Status available
VDRC Id 330118
CG Number (r6.01) CG4886
Sub-Category shRNA Stocks
Synonyms CYP33
Cyp33
Dcyp33
cyclophilin-33
cyp33
FlyBase gene number FBgn0028382
Insertion Site attP40
Viability viable
Inserted Chromosome 2
21bp Sequence (sense) AGGAGGACAGTTTCAAGCCTA
21bp Sequence (antisense) TAGGCTTGAAACTGTCCTCCT
Sequence ctagcagtAGGAGGACAGTTTCAAGCCTAtagttatattcaagcataTAGGCTTGAAACTGTCCTCCTgcg