330117

Sign In to show prices
SKU
SHRNA-330117
More Information
Library shRNA
Construct Id 330117
Status available
VDRC Id 330117
CG Number (r6.01) CG4781
Sub-Category shRNA Stocks
Synonyms 4781
CT15357
FlyBase gene number FBgn0035043
Insertion Site attP40
Viability viable
Inserted Chromosome 2
21bp Sequence (sense) TGGCGAGGTTGGAAGTTATAA
21bp Sequence (antisense) TTATAACTTCCAACCTCGCCA
Sequence ctagcagtTGGCGAGGTTGGAAGTTATAAtagttatattcaagcataTTATAACTTCCAACCTCGCCAgcg