330114

Sign In to show prices
SKU
SHRNA-330114
More Information
Library shRNA
Construct Id 330114
Status available
VDRC Id 330114
CG Number (r6.01) CG4665
Sub-Category shRNA Stocks
Synonyms DHPR
Dhpr
Dihydropteridine reductase
FlyBase gene number FBgn0035964
Insertion Site attP40
Viability viable
Inserted Chromosome 2
21bp Sequence (sense) CGGCCTGTGTCGATCACTTTA
21bp Sequence (antisense) TAAAGTGATCGACACAGGCCG
Sequence ctagcagtCGGCCTGTGTCGATCACTTTAtagttatattcaagcataTAAAGTGATCGACACAGGCCGgcg