24522

Sign In to show prices
SKU
GD-24522
More Information
Library GD
Construct Id 7718
Status temporarily unavailable
VDRC Id 24522
CG Number (r6.01) CG12405
Synonyms AOP2-related
BEST:LD11278
DPx-2540-1
DPx2540
Peroxiredoxin 2540
Peroxiredoxin 2540-1
Prx2540
Prx2540-1
peroxiredoxin 2540
FlyBase gene number FBgn0033520
FBgn0040497
Viability sterile
Hairpin Length 311
ON Targets 2
OFF Targets 2
s19 0.72
CAN Repeats 3
Inserted Chromosome 2
Left Primer CGCGAATTCCCACTGAGCTGGGCAGGATTG
Right Primer GCGTCTAGAGGACATGGGGTAAAACATGGAGAGG
Template genomic
Sequence CCACTGAGCTGGGCAGGATTGCGGTGCACCAGCCGGAGTTTGCCAAGCGGAACACCAAGTGCCTGGCGCATTCCGTTGACGCATTGAACTCGCACGTGGACTGGGTGAACGACATCAAGAGCTATTGCCTGGACATTCCCGGGGACTTCCCCTACCCGATCATCGCCGACCCTACTCGCGACCTGGCCGTCACCCTGGGCATGCTCGACGAGGAGCAGAAGAAGGATCCCGAGGTGGGTAAGACCATCCGCGCCCTGTTCATCATCAGTCCGGACCATAAGGTGCGCCTCTCCATGTTTTACCCCATGTCC