24520

Sign In to show prices
SKU
GD-24520
More Information
Library GD
Construct Id 7680
Status available
VDRC Id 24520
CG Number (r6.01) CG14154
FlyBase gene number FBgn0036093
Viability viable
Hairpin Length 387
ON Targets 1
OFF Targets 0
CAN Repeats 4
Inserted Chromosome 3
Left Primer CGCGGATCCGCAGGAGGGAGGAGGAAATGG
Right Primer GCGTCTAGACGCCACAGCACTTGAGCAGA
Template genomic
Sequence GCAGGAGGGAGGAGGAAATGGAACGCAAGCGGGAACTGGAGCGGCGAAAGGAACTCGCGAGGGAAAAGGAACGAGAGAAAAAGCAGCATCAGCAGGAGTGGCGCAAGGAACTGGAGAAGGAACGTCAGCGTGAAAAGGAATTGCAGCGTGAACATCTGAGGAAGGAGCCATCCACTTCCTCCAAAAGGGTAAATCCAGAAATCACCAAATTCGACGAGGAATTCGAGCAGGATATTCAGAAGTTGGAGCAAAGCATTTGCCAGCTGGACTTTCGCTCCAAAACGATGGCCACCATGTGGATGGACAAGCTGCGCCAACCACCACAAAATGCAGACGAGGCCAGATCTAGGAACATAATAACATCCCATCTGCTCAAGTGCTGTGGCG