200105

Sign In to show prices
SKU
VT-GAL4-200105

File(s)

There are no file attachments for this product.
More Information
Library VT-GAL4
Construct Id 245154
Status available
VDRC Id 200105
Synonyms DrmSIFR
SIF-R
SIFR
SIFa-R
SIFaR
SIFamide receptor
SIFamide-receptor
anon-WO0170980.43
anon-WO0170980.44
FlyBase gene number FBgn0038880
FBgn0046533
FBgn0046534
VT ID 45154
Viability viable
Inserted Chromosome 3
Transcriptional Activator GAL4
Insertion Site attP2
Verification Status verified
BrainBase 40075
FlyEnhancers VT45154
Sequence Length 2034
Left Primer GGTCGGAATGGGCATGGGTACACTA
Right Primer GCAGTCCTCATTCAGACGCGAATCC
Template genomic
Sequence GGTCGGAATGGGCATGGGTACACTAGTCGTCGTACTGGGAACGTCGCCACTTGTATGGCTTTTATGCTTTCGCTTGCGAATCCGCCCGCTGGCTGCCATCATCAAATCATCCGGCGTCTTGATTGGGCGGATGGCACTTTCACTGGCGCCTCGCTTTCGCTATCACTATCTGTAGACGTATCTCGAATCTTGAATCTGGTATCTCGCTTGTTTTAGAAAAGGTCTATAAAAATGGCATCGTCACTTGGCATTTCGTTGGCTTGTGTAGGATATGCAGGAAGTTTCGTGGCTTTGGGTTAGAGAACAGTTTTTAATTAACACCCATGTCCATACAATATCTCGTTTATCCGGGGATTGTTTTGCGTTTGCCCCGAAGTTGCACAATAAATGCAGTTTTCTAGAAACTCGCTTCTAGCGCCCAAGGACCCTTCCGTTTTCGTTTTTTTTTTTTTTGATTGAAATCACCTACAAAAGTTTGTTGCCGTTTCGGCTGCGAATCCGAGTGCGGAATGCAATGCATTGCCTGGGTCGTTCGTCAGCTGGTTGACGTTGCCTTGGCTGGCATTACGAAAAAGTCGGCGGCCCAAGGCCTCGTGTGCATATTTCAGATAAGGCCAGATGCTGGGTGCCTGGATAAATGCAGCTAGAGGGGATTGGGGATCGGGCATTGGGCATTGGGCATTGGGCATTGGGCATCGGACATCGGGCAAAGGAGCCGAGAGCATCGGCTCAGGGACATGGTCACCGCCACAGTTGCAACACATGCGCGTCGCTAATTAATTTTAATGCCCGTTCTGCCATTGTTTGGCTGTTGTTTTTGGCACAATTGAAAAGCCAGCGAGCGTGCACTTTGACCTCAAAAAATCGACACCAAACATCGAACAAACGAGCAATTGAGCAACTCAATAGCAGCGCATAAAAATTCCATTAAGCACAACTGCCAAGCGCACGCAGCACTCTTCGATTGAGTGCCAAAAAATTGCCAGTAAGCATTGAAACAATTGGTAACAAACGAAGCCAGTGCGACATTCTTTTGTGCGGTTCCATGGGAGTGTCCACATCAGACAAACTGGCGACTAAGGGCCCCTCGGCACACAATTCAAACTGACCACGCACAGCAAAAAAAAGAAAAAAAACCAAATAAAGAAAGACTTCCAAAAATTCAACATTAATAATTAAGTATCATCAATGATTTAATTGGGCCTAAAAGGCATTTATCTGAAGAGTTTTTAATATGATCCTAAATGTGTATCAAATGGTTGAATAGATTGTTTGCCTATTTCAAGTTCAGTTCACACAAAAATTTTAATATTTTAAAAAATATTTATGCATGTCATAACGGATTTGATTGATGAGATTTTTAACCGAACAACAGAAGGAATACATCATTTTCCATAGTATATCCTCAAAGTTAAAAGAGAAATGAAAATTGCTGAAAAAGCTGAATTTACATTTGCCAAAGCTGTGCAATCAGTTGCGAAGTTTTAACTGTTGATACCAAGTTGAAAGTCAACTTTTTCCGTGTAGCTCCTCAGCTGGCGTTCCTTTCGGAATTGGATTGGGACCTTTTTCGAGCGTGAAAGTGCTCGGGACCTAATTGAGCTTACATGCCTGCTGGCCAACTTGGAGGCGATGCCAATGCCGATATAGTCCTTAACGTGGCCCCACGGCGCAATGGGGCGTAAGACAAAGTGTCAACACTGGGACAAATCGGGCAAACTAATTAAACTGTCGGAGGGCTAACTCAACGCGAAGCTGCAAGATACTACCAGAGCAGATGCAATTCCTAAGGGACGATGCGCGAAAAAATGGGGGAAACTCCCACAACTGCAGGTGCAGATGGAGACAGAGCAAGCACAAACAAACACTCCCACGGATAAATCAGATTCAGGACATGGACATGGATGCTCGAAAGGTTAACACTACGCGTGGTCGTTTCCGTGGTGCGATATCGTGGGTCGTGGGACGTGGATATAGTCATCCGCCCCTGGGGCGACCGCGTTGTCAACGGATTCGCGTCTGAATGAGGACTGC